a method of creating a quasi resonant family
The Art Of Creating A Successful Blog – Tips From The Pros
... TopSecretWriters was dif f erent It wasn’t work It was less about making money, and more about having lof ty goals and ideas to share that I am passionate about It was my way of tossing my message in a bottle ... that was actually limiting at all in any way, since there weren’t the library of readymade tools available to “add-on” to the base platf orm Joshua didn’t hesitate to point out that the Vox platf ... Come…Eventually Was there a lot of up-f ront investment and loss required to get that early growth started? Can you share at what point that Smashing Magazine became prof itable, and what that f elt...
- 10
- 566
- 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family ... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... Km(lM) Relative Vmax (% of coumarate) Relative Vmax/Km (lM)1) Gm4CL1 Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate...
- 12
- 448
- 0
Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot
... HinCel 6A and CcCel6C (Fig 2) indicated that Asp150 and Asp334 of CcCel6C are the potential catalytic residues and could act as a proton donor and a base, respectively Another aspartic acid residue ... et al crystal structure of a cellulase was reported; it was a catalytic domain of Hypocrea jecorina Cel 6A (HjeCel 6A, formerly designated cellobiohydrolase II), a GH6 cellobiohydrolase from an ascomycete ... min, and the solution containing the ligand also acted as a cryoprotectant The diffraction data were collected at beamline PF-AR NW12 (Photon Factory, Tsukuba, Japan) The data were processed and...
- 11
- 489
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Nakazawa, H., Takamiya, M., Masuda, S., Funahashi, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., ... S., Kawashima-Ohya, Y., Watanabe, K., Yamazaki, M., Kanehori, K., Kawamoto, T., Nunoshiba, T., Yamamoto, Y., Aramaki, H., Makino, K & Suzuki, M (2000) Archaeal adaptation to higher temperatures ... horikoshii; Pa, P abissi; Ss, S solfataricus; St, S tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex...
- 12
- 506
- 0
Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx
... The questionnaire was translated to Kiswahili as a language familiar to most Tanzanians Data was gathered by an anonymous questionnaire The knowledge test consisted of 10 items and asked students ... data and FM and MI analyzed data FM and SH and MI participated in reviewing and drafting the manuscript in all stages All authors read and approved the final manuscript Competing interests The authors ... evaluation of a school-based adolescent sexual heath intervention in rural Tanzania: MEMA kwa Vijana programme Health Educ Res 2006, 22:500-512 18 Todd J, Changalucha J, Ross D, Mosha F, Obasi...
- 9
- 580
- 0
Fermentation as a Method of Food Processing ppt
... German salami (smoked), Italian salami, Lebanon bologna (sausage), Longaniza (sausage), and Teewurst are typical fermented meat products of Europe While paak made of fish and cereal by lactic acid ... bacteria had a wider range of activity against mutagens than those produced with a single strain of lactic acid bacteria (Tamai et al., 1995) Antimutagenic properties of the methanol extract of kimchi, ... 1/10 to make a laboratory scale, see appendix Materials and methods Materials Cereal grains Commercial quality wheat flour of 70% extraction rate designated as "bagerivetemjöl" was obtained from...
- 65
- 538
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... macrophages and lymphocytes increase in number at sites of inflammation and each are capable of modifying the overall inflammatory response [23] Eosinophils, are of particular interest in asthma ... evidence that inflammatory cell infiltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro-inflammatory agents Activated...
- 14
- 540
- 0
AN IMPROVED METHOD OF CONSTRUCTING A DATABASE OF MONTHLY CLIMATE OBSERVATIONS AND ASSOCIATED HIGH-RESOLUTION GRIDS docx
... Europe and South America is particularly acute The temporal and spatial density of observations may be due to the limitations of this particular database, of data exchange and storage, or of the ... there is an adequate set of stations with a complete record Although the normal may vary considerably over a small area, for most aspects of climate the variations from year to year take place on ... data, and not all stations have been assigned WMO codes, so additional information was used: location, name and country Each additional station was compared with the stations already in the database,...
- 20
- 443
- 0
Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf
... tunicamycin) [12] Cells transfected with the D93H mutant THTR1 and treated with tunicamycin displayed a similar lack of plasma membrane localization of the mutant transporter as well as a typical ... instructions of the manufacturer (Stratagene Inc.) Primers used for mutagenesis of THTR1 (D93H) were: Upstream oligo: 5¢-CCTGTGTTCCTTGCCACACACTACCTCCGTTA TAAACC-3¢ and downstream oligo: 5¢-GGTTTATAACG GAGGTAGTGTGTGGCAAGGAACACAGG-3¢ ... solute carrier family Amino-acid alignment of the aspartate 93 in human THTR1 with various members of the SLC19 family The conserved aspartate 93 is indicated in bold Light shading indicates the amino...
- 9
- 480
- 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx
... genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI sites ... Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal Trans-2-nonenal Furfural Acetone 100 90 45 15 79 ... (6% acrylamide) and reductase activity staining of yeast extracts and purified enzymes The gel was incubated with 10 mM pentanal and mM NADPH and activity bands were revealed as indicated in Materials...
- 8
- 378
- 0
a memoir of jane austen and other family recollections dec 2002
... condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available ISBN 0–19–284074–6 10 Typeset in Ehrhardt by ... of Aunt Jane than Lady Knatchbull’ (see pp –) But in the same place Anna also writes that Fanny’s family, the Knights of Godmersham, felt a general preference for Cassandra Austen and that ... set of five illustrations– a portrait of Jane Austen, a facsimile of her handwriting, and family drawings of Steventon Parsonage, Steventon Manor House, and Chawton Church––an important feature of...
- 352
- 296
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... (Invitrogen, CA, USA) and stored at -80°C until total RNA isolation was performed Tissue samples from patients after surgical removal were placed in RNALater and stored at -80°C RNA isolation and cDNA synthesis ... sodium acetate, mM EDTA, 200 mM paraformaldehyde; pH 7.0; SigmaAldrich) μg of total RNA was used for cDNA synthesis Mixture of RNA, universal oligo(d)T 10 primer and RNasefree water was incubated at ... PCR data was assembled using the LightCycler computer application software 4.05 dedicated for the LightCycler 2.0 All data was analyzed using the Statistica Software ver 6.0 (StatSoft, Poland)...
- 9
- 460
- 0
báo cáo hóa học: " Effects of short duration stress management training on self-perceived depression, anxiety and stress in male automotive assembly workers: a quasi-experimental study" docx
... also like to thank Miss Mazalisah Binti Matsah, Dr Ahmad Syaarani Bin Yasin, Dr Nik Khairol Reza Bin Md Yazin for technical assistance and Mr Kamarudin Hussin, Research Assistant, for secretarial ... Hirokawa K, Tsuchiya M, Kawakami N: The immediate effects of 10-minute relaxation training on salivary immunoglobulin A (s-IgA) and mood state for Japanese female medical co-workers Acta Med Okayama ... Blumenthal J, Sherwood A, Babyak M, Watkins L, Waugh R, Georgiades A, Bacon S, Hayano J, Coleman R, Hinderliter A: Effects of exercise and stress management training on markers of cardiovascular risk...
- 9
- 494
- 0
báo cáo hóa học:" A general lithography-free method of micro/nanoscale fabrication and patterning on Si and Ge surfaces" doc
... A general lithography-free method of microscale/nanoscale fabrication and patterning on Si and Ge surfaces Huatao Wang1,2 and Tom Wu*1 Division of Physics and Applied Physics, School of Physical ... slowly at 250°C Furthermore, Si has a high melting point of approximately 1,400°C, while Ge melts at a much lower temperature of 938°C Although the surface of a particular material often melts at a ... investigated, and there are few examples of lithography-free patterning of Ge surfaces in literature Here, we demonstrate a vapor transport-based method to fabricate shape-controlled nanostructures and...
- 14
- 427
- 0
the monk and the riddle the art of creating a life while making a living randy komisar
... year will make that a bargain And I can quote comps.” “Lenny, you have an idea, a cofounder, and a business plan Nothing earthshaking or inherently valuable like an exclusive market or a key patent ... without a sound More endless highway A scattering of thatched houses on stilts An occasional open-air market We slow down for water buffalo pulling a caravan of carts and weave paths around lumbering ... senior management and report progress against plan I once sat on the board of a startup that had raised an initial round of funding from a wealthy Hollywood financier This was the kind of startup...
- 105
- 711
- 0
Báo cáo toán học: "A Quasi-Spectral Characterization of Strongly Distance-Regular Graphs" ppsx
... Fiol and E Garriga, Pseudo-strong regularity around a set, submitted [12] M .A Fiol, E Garriga, and J.L .A Yebra, On a class of polynomials and its relation with the spectra and diameters of graphs, ... 299–303 [7] M .A Fiol, An eigenvalue characterization of antipodal distance-regular graphs Electron J Combin (1997), no 1, #R30 [8] M .A Fiol, Algebraic characterizations of distance-regular graphs, Discrete ... numbers of vertices at maximum distance from each vertex—is needed to characterize them Then we speak about quasi- spectral characterizations, as those in [7, 14] (for antipodal distance-regular graphs)...
- 9
- 292
- 0
Báo cáo toán học: "The subword complexity of a two-parameter family of sequences" pps
... this paper we investigate an additional property of the class of heap games for general s, t ∈ >0: the subword complexity of the characteristic function of A For fixed s, t ∈ >0, define the characteristic ... player who reaches a state where both heaps are empty wins The special case s = t = is the classical Wythoff game [15], [16], [5] Fraenkel showed [11] that every possible position in a game of ... problem of computing the subword complexity of a given sequence has been addressed in a number of earlier works For a survey of results in this area, we refer the reader to [2] and [8] In particular,...
- 19
- 293
- 0
Báo cáo toán học: "Enumeration of alternating sign matrices of even size (quasi-)invariant under a quarter-turn rotation" pot
... number AQT (4N) of ASM’s of size 4N invariant under a quarter-turn (QTASM’s) is related to the number A( N) of (unrestricted) ASM’s of size N and to the number AHT (2N) of ASM’s of size 2N invariant ... Kuperberg’s method we introduce square ice models associated to ASM’s, HTASM’s and (q)QTASM’s We recall here the main definitions and refer to [7] for details and many examples Let a ∈ C be a global parameter ... a specialization of the variable x Moreover, by using Lemma 11 and (when a = ω6 ) Lemma 13, we obtain for Z, ZHT and ZQT , 2N independent specializations of the variable x 4.4 Special value of...
- 20
- 188
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25