a media query for smartphones in landscape mode
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... immunogenicity The PEGylation consists in binding with a covalent link a protein (adenosine-deaminase, asparaginase, interferons, granulocyte colonystimulating factor, liposomal doxyrubicin) to poly(ethylene) ... of activity Int J Med Sci 2007, 4 Rasburicase pharmacokynetics Information about pharmacokinetics derives by the use of rasburicase in children and young adults Few data are available in adults...
- 11
- 715
- 0
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc
... valency and thematic role change in causatives To model interactions between domains, we propose a categorial approach in which composition in all domains proceed in parallel As an implementation, ... functions as a basis for grammatical analysis In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language Structures, D Reidel, Dordrecht, 1988 C Pollard and I A Sag 1994 ... m a t i o n S t r u c t u r e and Tactical Constraints Entries in the eategorial lexicon have tactical constraints, grammatical and semantic features, and phonological representation Similar...
- 3
- 339
- 0
Pro Android Media: Developing Graphics, Music, Video, and Rich Media Apps for Smartphones and Tablets docx
... setting of the file in a standard location on the device and has facilities for storing and retrieving metadata about that file Metadata is data about data; it could include information about ... Metadata EXIF, which stands for exchangeable image file format, is a standard way of saving metadata within an image file Many digital cameras and desktop applications support the use of EXIF data ... stuck in landscape mode Figure 2–2 The camera preview in landscape Setting Camera Parameters As previously mentioned, the Camera class has a nested Camera.Parameters class This class has a series...
- 321
- 2,872
- 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx
... Changing appraisal processes and enhancing coping skills are the fundaments for coping with stress more effectively Therefore, learning a method for managing demands and stressors, and altering ... clinical and non-clinical populations with psychological complaints and has been validated in primary health care [31,32] and in occupational health care [7,29] The four scales of the DSQ are internally ... to as a stress management training [35,36] And although the term stress management training may suggest a rather uniform set of intervention strategies, it usually refers to a mixture of treatment...
- 8
- 396
- 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps
... Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for schizophrenia in offspring in a Japanese population ... TF, Saha S, Welham J, O’Callaghan E, Cantor-Graae E, Chant D, Mortensen PB, McGrath J: Paternal and maternal age as risk factors for psychosis: findings from Denmark, Sweden and Australia Schizophr ... well as other overlapping processes In 2002, Malaspina et al reported that the paternal age at birth of sporadic cases averaged 4.7 years older than familial cases of schizophrenia, and attributed...
- 6
- 405
- 0
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx
... The measurements were made in triplicate Histopathological analysis of joints Histopathological features of peripheral joints were assessed in hematoxylin-stained formalin-fixed paraffinembedded ... 99:245-250 Sakata K, Sakata A, Vela-Roch N, Espinosa R, Escalante A, Kong L, Nakabayashi T, Cheng J, Talal N, Dang H: Fas (CD95)-transduced signal preferentially stimulates lupus peripheral T lymphocytes ... an allelic combination derived from the original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis...
- 11
- 469
- 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx
... Kit (Qiagen Inc., Valencia, CA, USA) from a small tail snip taken between and weeks of age just prior to weaning Each DNA sample was used as a template in polymerase chain reaction amplification ... recombinant founder pair was identified, the RI line was maintained via a single line of descent All RI lines were bred and maintained under specific pathogenfree conditions in the animal facility ... presence of ANAs, in particular anti-SS -A/ Ro and antiSS-B/La in the sera of human patients, is one parameter in the diagnosis of clinical SjS Concomitantly with the appearance of mononuclear leukocytes...
- 12
- 399
- 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx
... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature),...
- 8
- 341
- 0
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx
... for human bactin, 5’-TGGCACCCAGCACAATGAA-3’; and reverse primer for human b-actin, 5’-CTAAGTCATAGTCCGCCTAGAAGCA-3’ Primer efficiency was determined by serially diluting a standard RT reaction product ... USA) We repeated the ELISA three times and obtained the similar results Sandwich ELISA has low inter-assay and intra-assay variability and provides more accurate results than direct ELISA in ... http://arthritis-research.com/content/13/4/R124 washing step, a 15,000-fold dilution of anti goat IgG alkaline phosphatase-conjugated antibody (Sigma) was added, and plates were incubated for 30 minutes at room temperature Following another...
- 16
- 321
- 0
Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx
... were against positions 1119-1138 (5’ CCCAAAGTCTCT CACATTA-3’), 1272-1280 (5’-GGACAAACTTAAC AACAAT-3’), 1591-1609 (GCAAGGGAAGGAATATGTA-3’), and 2070-2088 (5’-GCTAATGGCTGG ATTTATT-3’) TZM-bl and ... domain potentially responsible for this increase was further investigated ADAM10 E38 4A plasmid contains a single inactivating point mutation in the metalloprotease domain rendering the metalloprotease ... domain, it also contains a disintegrin domain, an EGFlike domain, a cysteine-rich domain, a transmembrane domain, and a cytoplasmic domain [13] ADAM10 is required in NOTCH signaling during embryogenesis...
- 14
- 308
- 0
Báo cáo y học: " A retrospective cohort pilot study to evaluate a triage tool for use in a pandemic" pps
... 'transfer to another acute care facility' Statistical analysis We present descriptive data using mean and standard deviation for continuous variables, or median and interquartile ranges if data ... criteria Severe trauma N /A N /A Severe burn N /A N /A Cardiac arrest N /A 12 N /A Severe cognitive impairment N /A N /A Advanced neuromuscular disease N /A N /A Metastatic malignancy N /A N /A Advanced & ... care (%) 1 Awaiting cc/rehab Discharged N (%) N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A (3.3) N /A N /A (5.9) 63 N /A N /A 20 N /A N /A N (%) Life support (%) 43 N /A 90-day status* N /A N /A Home (46.1)...
- 9
- 271
- 0
Mechanisms of neurodegeneration and stem cell migration a study of molecular signals in the model of axotomy
... through an axon Most materials like tubulin, actin and neurofilamentous proteins are transported anterogradely from the perikaryon to the axon terminal at a fast and a slow rate In mammals, fast transport ... is causally related to the degree of brain injury, includes: (1) the capacity of pro-inflammatory cytokines to exacerbate brain damage; (2) the capacity of proinflammatory cytokine blockade to ... Still later, after axonal outgrowth has been initiated, there may be an increase in the overall amount of proteins that are axonally transported or in their rate of transport or both (Grafstein,...
- 288
- 337
- 0
Laying the foundations a new era for rd in the middle east
... geographical good fortune Situated halfway between Europe and Asia, and with fast-growing regions such as the Asia Pacific region and Africa within striking distance, the Middle East has an enviable ... years ago.” Better co-ordination between regulators that review marketing authorisation and those that regulate clinical trials should lead to an increasing volume of late-stage R&D taking place ... Arab Emirates in 44th position But over the past few years, investment in the infrastructure and institutions for R&D has accelerated dramatically in some countries Qatar, the UAE and Saudi Arabia,...
- 42
- 221
- 0
10 steps in developing a strategic social media plan for your business
... of social media at solving that problem Choose a metric that’s indicative of that goal’s progress and is easy to measure Social media evolves rapidly so your tactics may have to change later T ... track Capture multiple analytics as some metrics may later become a better KPI af ter you have had the experience of measuring and analysing the data Roll out st rat egy Once you have f inalized ... need to develop a social media strategy that will generate meaningf ul and real returns f or the business T he 10 steps in developing a strategic social media are: Align with the business Discover...
- 6
- 834
- 0
The 10 Steps In Developing A Strategic Social Media Plan For Your Business
... cost of that tactic Thanks for reading our 10 steps in developing a strategic social media plan for business How would you go about developing a social media strategy? What would you add? Did ... goals and their associated KPIs will vary Speak with and analyse the requirements of each department and work out what level of resource is available f or social media # Def ine goals Analyse any ... buy -in f rom individual departments and management Add timelines and assign tasks Identif y and provide any required training/tools/supports Agree and manage roll out Only sign of f af ter the above...
- 5
- 460
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... (primer A and C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers A and C) a faint 540 bp band (indicative ... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase ... serve as a valid and convenient in vitro model system for studying the cellular activities and regulation of transplacental transport and uptake mechanisms To date, only limited information on binding...
- 12
- 470
- 0
Model Policy Guidelines for the Appropriate Use of Social Media and Social Networking in Medical Practice ppt
... bulletin board system Hashtag - A hashtag is a tag used on the social network Twitter as a way to annotate a message A hashtag is a word or phrase preceded by a “#” Example: #yourhashtag Hashtags are ... electronic and digital media by physicians (and physician assistants, where appropriate) that may be used to facilitate patient care and nonprofessional interactions Such electronic and digital media include, ... ethics, and physicians need information on the importance of maintaining the same professional and ethical standards in their online activity or communications using other forms of electronic media...
- 17
- 720
- 0
Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx
... on the MH agar plate Aeromonas hydrophila had larger zones of ampicillin-sulbactam and amoxicillin-clavulanic acid on poloxamer gels than MH agar This was also true for Bacillus licheniformis when ... Table 1: Mean [± standard error] zones of clearance (mm) around all the antibiotics for Gram negative bacteria [NM – Not measured Amoxycillin/ Clavulanic acid Ampicillin/ Sulbactam Ampicillin/ ... microorganisms The aim of this research was to test a more clinically relevant biofilm model for assessing the efficacy of antimicrobial agents against microorganisms of clinical and veterinary importance...
- 10
- 256
- 0
Báo cáo sinh học: " A criterion for measuring the degree of connectedness in linear models of genetic evaluation" ppt
... will have to compare different models and there are now specific statistical procedures available to that in animal breeding (Wada and Kashiwagi, 1990) APPENDIX Another look at the standardization ... the incidence of an unbalanced distribution of data across the nuisance factors This change in C implies a related change in the variance covariance matrix of estimated breeding values which influences ... (1984) An Introduction to Multivariate Statistical Analysis John and Sons, New York Baker RL, Paratt AC (1988) Evaluation, selection and diffusion of sires using artificial insemination and/or natural...
- 16
- 272
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25