a laser scanner system for acquiring archaeological data case of the tyre remains
Lore: A Database Management System for Semistructured Data ppt
Ngày tải lên :
23/03/2014, 12:20
... smaller than the original database Figure shows a DataGuide for the sample OEM database from Figure In Lore, a DataGuide plays a role similar to metadata in traditional database systems The DataGuide ... created before any data is loaded; in Lore, DataGuides are dynamically generated and maintained over all or part of an existing database For a given OEM database, there are many DataGuides that ... snapshot of the Java presentation of a DataGuide This DataGuide summarizes an existing database for Stanford's Database Group, similar in structure to but much larger than the sample database...
- 13
- 270
- 0
A Fast File System for UNIX
Ngày tải lên :
12/09/2012, 14:16
... insufficient space to hold the new data) If space exists in a block already allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full ... contain insufficient space to hold the new data) If the size of the new data plus the size of the data already in the fragments exceeds the size of a full block, a new block is allocated The contents ... space for a small amount of data, the remaining fragments of the block are made available for allocation to other files As an example consider an 11000 byte file stored on a 4096/1024 byte file system...
- 14
- 1K
- 0
A web-based system for notifying environment violation.doc
Ngày tải lên :
27/10/2012, 16:40
... in the next chapters 2.3.2.3 Data access tier It consists of the database server that contains all logic data of application Separating logic data from application into it will make program scalable ... contents - Access database server to query information: use the database connection provided by the language platform to access database, manipulate it for expected logic data We will explain the business ... associated with a map There are different kinds of data representation on a map: raster data type and vector data type - Raster data type: is any kind of digital image, in which a pixel is the smallest...
- 56
- 410
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên :
05/09/2013, 09:08
... compared with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use ... from all classes The total number of training data pixels was 4,000, which corresponds to 15% of total data All input data were quantized to 15 values based on equal width interval for optimal Bayesian ... 2005 A Landsat Thematic Mapper (TM) image (obtained on 09/03/1990, path 41 row 36) was used as our satellite image We used all seven TM spectral bands and geospatial ancillary data, the coordinate...
- 7
- 575
- 0
Tài liệu Ethernet Distribution Frame Centralized Cross-Connect System for Managing Ethernet Data Services pptx
Ngày tải lên :
22/12/2013, 12:15
... element bays is essential for carrier-class reliability and availability A system of vertical cable managers with integrated slack managers not only offers proper management of cables, but also provides ... improved system reliability and availability by reducing the chance for damage to adjacent fibers during routine maintenance of individual fibers Conclusion Earning customers for value-added data services ... • Select a standard patch cord length of less than 10 meters for the EDF and use slack managers in vertical cable managers for routing and storage of extra cable lengths (see Figures and 4) This...
- 4
- 400
- 1
Tài liệu A Knowledge Management System for ERP Implementation pdf
Ngày tải lên :
16/01/2014, 16:33
... rapidly AMR Research, an authoritative market forecast institution in America, indicated that the ERP market would grow at annual rate of 37% in recent years The sales of the ERP packaged software ... question can be asked again and again and the quality of the answers can not be guaranteed Therefore, the organization can have personnel in charge of monitoring and tracking questions and sending ... Organizational integration and internal function coordination are realized At the infusion stage, the system is used to enhance the performance of the organization (Rajagopal, 2002) After years...
- 12
- 622
- 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
Ngày tải lên :
20/02/2014, 21:20
... interpretation is available for each syntactic node This is guaranteed by the semantic rule formalism and by the fact that every lexical item has a semantics associated with it Table contains average ... 2.7), and a lexicon All three are written in a variant of the unification formalism used in the Core Language Engine (Alshawi, 1992) The basic building block of the grammar formalism is a category ... 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, Eds Japanese Syntactic Processing, Hillsdale, NJ: Lawrence Erlbaum Associates...
- 8
- 376
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
Ngày tải lên :
16/03/2014, 01:20
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
Ngày tải lên :
17/03/2014, 10:20
... 30, 45 and 60 mM SA at 37 °C for h, and further incubated at 37, 39 or 41 °C for h without SA Then, luciferase or b-galactosidase activity was assayed Each value represents the mean ± SD of three ... against various forms of stress [1] Here we showed that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase ... Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a subsequent...
- 8
- 470
- 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
Ngày tải lên :
23/03/2014, 14:20
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... contradiction between two criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
- 5
- 347
- 0
Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc
Ngày tải lên :
31/03/2014, 00:20
... gold standard A better evaluation (e.g., a gold standard based on manual analysis of the corpus data and annotation for SCFs) should not yield these errors In other cases (e.g interpolated clauses), ... Proceedings of the 3rd Conference on Language Resources and Evaluation, volume IV, pages 1351–1357, Las Palmas de Gran Canaria, Spain Mihai Surdeanu, Sanda M Harabagiu, John Williams, and Paul Aarseth ... still the easiest and fastest way to get an idea of the performance of the system We built a gold standard using the SCFs found in the Tr´ sor de la Langue e Francaise Informatis´ (TFLI), a large...
- 6
- 391
- 0
báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx
Ngày tải lên :
19/06/2014, 08:20
... measured force values For all parameters, the mean values as well as the variances were calculated For evaluating the differences in the parameters among different groups, analysis of variance (double-sided ... given as a percentage of the Page of 11 maximum desired amplitude and allows variations of v ·b in positive and negative direction of the exact path The parameter for the whole training set is then ... of the material as a consequence of an applied force Strain gauges change their electrical resistance with mechanical deformation, especially elongation The maximum relative lengthening ε of the...
- 11
- 524
- 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
Ngày tải lên :
20/06/2014, 00:20
... evidence of the stability of the syndesmosis may be obtained • The final test for stability of the calcaneofibular ligament is carried out by percussion of the examiner's fist against the heel of the ... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the ... into account the fact that occupational medical prophylaxis does not aim primarily at producing a therapeutic indication but at prevention From the large number of available validated tests for...
- 10
- 575
- 0
Báo cáo hóa học: " Research Article CARNIVORE: A Disruption-Tolerant System for Studying Wildlife" docx
Ngày tải lên :
21/06/2014, 11:20
... election, and data transfer (Figure 6) Each of these utilizes the MAC layer to send and receive data A single MAC layer task parses frames rapidly and updates the state variables for each task A neighbor ... Once a data request is received, the node picks a data type to send If no data of any kind is available, the sender sends an end -of -data packet to terminate the transfer If the node has data to ... download of GPS data is available, but the radio links used would not accommodate the large amounts of data the CARNIVORE platform records Cellular GSM technology is also used and has a higher data...
- 14
- 378
- 0
báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx
Ngày tải lên :
21/06/2014, 20:20
... suppose that the local variances of the noise-free part of the acquired image are identical with the local variances of the first result With the aid of the masks, the classes of the first result can ... volume of data is six times higher than the initial volume of data With the aid of the six masks generated at the end of the first stage, the six classes of each partial result are identified Using the ... especially in the case of very noisy images An objective measure of the homogeneity degree of a region is defined by the ratio of the square of the mean and the variance of the pixels situated in the...
- 14
- 326
- 0
Báo cáo hóa học: " A Multiple-Antenna System for ISM-Band Transmission" potx
Ngày tải lên :
23/06/2014, 01:20
... techniques There are two principal approaches to get a performance gain from an antenna array One approach uses the known geometric constellation of the antennas for beamforming The other approach is ... in-phase and quadrature (I/Q) data, for example, Hiperlan/2 or UMTS frames, are generated by the simulation system of choice The impulse shaping is done in the digital domain The data is scaled and ... conjugate complex channel coefficient The resulting values of all receive antennas are then added up separately for each subcarrier and afterwards, in case of QAM symbols, normalized to the sum of...
- 13
- 318
- 0
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx
Ngày tải lên :
06/08/2014, 19:21
... compared to the databases in order to characterize the biological community of a given habitat One of the advantages of this approach is the recovery of DNA sequences from organisms that cannot be ... insect-crustacean sister-group relationship is mainly based on the comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, ... representing a large number of bacterial species in each dataset The majority of the sequences were from the Proteobacteria but many other taxa were also detected No clear evidence was found for the presence...
- 4
- 318
- 0
Vertical Shaft Plumbness Using a Laser Alignment System potx
Ngày tải lên :
08/08/2014, 13:20
... through the use of a laser and a computer for data acquisition This helps to ensure that the accuracy of the measurements are not user dependent In addition, the Permaplumb system offers a measurement ... accurately by the operator or the person in charge of evaluating the data It is apparent that there are many factors involved in tight-wire measurements that can induce error strictly from the measurement ... indicators Data can be acquired in one turn of the shaft, thereby speeding up the process of correcting and detecting “dog leg” and run-out issues The equal loading of all of the pads of the thrust...
- 11
- 88
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
Ngày tải lên :
10/08/2014, 05:21
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... [36] The primary aim of the Page of present study was to develop and characterize nevirapine-loaded liposomes and to investigate the effect of various parameters on the size and the encapsulation ... out at SASTRA by LNR All authors read and approved the final manuscript Author Details 1Centre for Nanotechnology & Advanced Biomaterials (CeNTAB), School of Chemical & Biotechnology, SASTRA University,...
- 9
- 359
- 0