a group of radio buttons
Binding a Group of Radio Buttons in a Windows Form
Ngày tải lên :
07/11/2013, 13:15
... the data source and the data member, because the data source is a DataSet For a DataTable, an overload of the BindingContext indexer is used that takes only the data source argument Attach an event ... private DataSet ds; private SqlDataAdapter da; private BindingManagerBase bm; // private void RadioButtonForm_Load(object sender, System.EventArgs e) { // Create the DataSet ds = new DataSet( ... to data, there is no way to bind a group of RadioButton controls to a data source Binding a single radio button to a data source isn't a particularly common requirement—nor is it particularly...
- 6
- 583
- 0
How Is the Ku Klux Klan Like a Group of Real-Estate Agents
Ngày tải lên :
17/10/2013, 18:20
... for-sale ads they write A 66 The Ku Klux Klan and Real-Estate Agents phrase like “well maintained,” for instance, is as full of meaning to an agent as “Mr Ayak” was to a Klansman; it means that a ... onset of World War II and a number of internal scandals once again laid the Klan low Public sentiment turned against the Klan as the unity of a country at war trumped its message of separatism ... within a few years, there were already signs of a massive revival As wartime anxiety gave way to postwar uncertainty, Klan membership flourished Barely two months after V-J Day, the Klan in Atlanta...
- 30
- 550
- 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
Ngày tải lên :
20/02/2014, 02:21
... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢...
- 8
- 434
- 0
Lipid profile variations in a group of healthy elderly and centenarians pptx
Ngày tải lên :
22/03/2014, 14:20
... 0.001) Lipid profile variations in a group of healthy elderly and centenarians Table II Lipid parameters (mean values and standard deviation) AGE GROUPS GROUP A (70 -79 years) Total cholesterol1 (mmol/l) ... the normal range ADL and IADL tests suggest that nonagenarians and centenarians are the two groups composed of subjects characterized by the lowest physical activity This fact might be related to ... There was a statistically significant reduction in Apo B100/Apo A- I ratio between groups A and B (p< 0.025), groups A and C (p< 0.001), groups A and D (p< 0.001), B and D (p< 0.05) and C and D (p
- 5
- 448
- 0
Daughters of the Puritans A Group of Brief Biographies ppt
Ngày tải lên :
23/03/2014, 05:20
... hemorrhages of the lungs Did she have no more of them? Oh, yes; we are assured that "again and again she was attacked with hemorrhages and again and again prostrated by malarial fever." A physician ... journeys." Margaret was an apt pupil, and the good training of these many Cambridge mothers was apparent when, ten years later, Mr Emerson made her acquaintance "She was then, as always," he says, "carefully ... confidences, and to whom every question had been finally referred." At a later day, when Margaret was in Italy, reports came back that she was making conquests, and having advantageous offers of marriage...
- 76
- 357
- 0
Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot
Ngày tải lên :
19/06/2014, 08:20
... Clinical assessment in Group APA (Adapted Physical Activity) and in Group NSPA (Non-Specific Physical Activity) at baseline and months Group APA baseline Group NSPA after months p mean SD mean SD ... first metatarsal head, left first metatarsal head, right fifth metatarsal head, left fifth metatarsal head During posture analysis, in order to relate the displacement of the marker arrays to the ... Index of the Cumulative Illness Rating Scale [58] was adopted to evaluate physical health status The level of pain was measured using visual-analog scales [59] in: neck, thoracic spine and lumbar...
- 11
- 557
- 0
The phrase Phrase as a group of words, which makes sence, but not complete sense,
Ngày tải lên :
13/07/2014, 23:26
... The Phrase What is a Phrase? Phrase as a group of words, which makes sence, but not complete sense, it called a Phrase It is a group of related words without a subject and a verb Word /group of words ... old man disease Many case of infectious A story as old as time The Phrase A noun phrase: A noun phrase consits of a noun and all it modifies Ex: The senile old man Many case of infectious disease ... phrase Adjective pharse Verb phrase Adverb phrase Preposition pharse The Phrase There are five commonly occurring types of phrase in English: A noun phrase: A noun phrase consits of a noun and all...
- 9
- 512
- 0
THE SENTENCE (A sentence is a group of words which expresses a complete thought.)
Ngày tải lên :
13/07/2014, 23:26
... Sentence A declarative sentence A declarative sentences make statements or assertions For example: I shall arrive at there We must not forget that date 2.An imperative sentence An imperative ... ends with an exclamation mark For example: What a beautiful girl ! He is going to win ! The Four Sentence Structures A sentence can consist of a single clause or several clauses When a sentence ... sentence is a single clause, it is called a simple sentence (and the clause is called an independent clause) A sentence must contain at least one independent clause Below are the four types of sentence...
- 11
- 584
- 0
what is clause (A clause is a group of words that contains a subject and a finite verb)
Ngày tải lên :
13/07/2014, 23:27
... WHAT IS CLAUSE? A c laus e is a group of words that contains a subject and a finite verb Ex: I get slimmer and slimmer S A c laus e V constitutes only part of a sentence Ex: ... Types of clause Main clause (independent clause) These can stand alone because they express complete thoughts Subordinate clause (dependent clause) These can’t stand alone and need another clause ... noun, adjective, and adverb gfgghgnggggggggdis ghxhgxsjhajhabBDJ HSGDJHGDJHSDJH VXHDVHSVDHAVVS XHS Subordinate clause There are kinds of subordinate clause: noun, adjective, and adverb - An adjective...
- 8
- 621
- 0
Báo cáo y học: "Peanut sensitization in a group of allergic Egyptian children" pptx
Ngày tải lên :
08/08/2014, 21:20
... food allergy, is a good screening test to identify an individual at risk of food allergy and the rate of allergy in a sibling of an Table Variation of some clinical and laboratory data according ... negative OFC cases developed late phase reactions to peanut Two of the peanut allergic children were brothers (Table 1; patients and 2) They had bronchial asthma and attacks of urticaria and ... for parametric and the Kruskal-Wallis and Mann- Whitney Z tests for nonparametric data Fisher’s Exact and Chi square (X2) tests were used for comparison of categorical data Pearson and Spearman...
- 6
- 470
- 0
Báo cáo y học: " Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities" docx
Ngày tải lên :
11/08/2014, 16:21
... Miral s/n, 50009 Zaragoza, Spain Correspondence: Departamento de Psicolog a y Sociolog a Universidad de Zaragoza San Juan Bosco, 50009 Zaragoza (Espa a) E-mail: salavera@unizar.es ABSTRACT: Background: ... (Universidad de Zaragoza, Espa a) Departament de Psychology and Sociology Education Faculty, Zaragoza University, C/ San Juan Bosco, 50009 Zaragoza, Spain Physiotherapy Research Unit, Zaragoza University, ... stay in the center For statistical analysis of the data, the statistical program SPSS 15.0 version was used A descriptive analysis was performed (maxima, minima, averages and standard deviation)...
- 20
- 325
- 0
Báo cáo y học: "Dynamic features of the selective pressure on the human immunodeficiency virus type 1 (HIV-1) gp120 CD4-binding site in a group of long term non progressor (LTNP) subjects" pptx
Ngày tải lên :
13/08/2014, 05:21
... patients E, F and G In particular, a conformational epitope appeared to be present in patient E and G and formed by Thr278, Asp279 and Ala 281 In patient F, a complex and large area located partially ... The average viral mutation rate among all patients was estimated to be around 2.34E-02 mutations/site/year In patients A, B (normal progressors; NP), the average mutation rate (μ) was significantly ... Saag MS, et al.: Antibody neutralization and escape by HIV-1 Nature 2003, 422(6929):307-312 Balzarini J: Targeting the glycans of gp120: a novel approach aimed at the Achilles heel of HIV Lancet...
- 15
- 525
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
Ngày tải lên :
08/03/2014, 22:20
... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... enables expansin activation, accumulation and catalysis under identical pH conditions and explains how expansins may mediate acid growth of plant cell walls Theoretical pI calculations show that ... strong degradation of the full-length allergen and accumulation of a truncated 15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal peptide, as the N-glycosylated Asn residue...
- 10
- 535
- 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
Ngày tải lên :
22/03/2014, 20:20
... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in ... probability theory (cf [V2], [VDN]): a) A C ∗ -probability space is a pair (B, τ ) consisting of a unital C ∗ -algebra B and a state τ on B b) A family of elements (ai )i∈I in a C ∗ -probability...
- 66
- 378
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
Ngày tải lên :
23/03/2014, 11:20
... 2589 R sapE–F 2590 F sapE–R 2590 R mopB–F 3103 F mopB–R 3103 R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC ... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... core A similarity search against the translated GenBank nucleotide database (tBLASTn) revealed significant similarity between MCA2590 and an unannotated ORF of Methylomicrobium album (GenBank: U74385...
- 12
- 392
- 0
Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx
Ngày tải lên :
23/03/2014, 13:20
... AGU and DiGIR2DP9.2 AGU band Additional bands result from degradation of RNA during incubation at trans-splicing and RPA hybridization conditions Below; quantitation of RPA of trans-spliced GA ... reprogrammed product (RNA 2) + target GA RNA (RNA 3) The amount of trans-splicing ribozymes that had undergone the reaction [calculated as the amount of reprogrammed product (RNA 2) as a fraction ... reactions was approximately identical, the addition of the ribozyme band (RNA 4) in the fractions denominator gave approximately identical comparative results (data not shown) percentage) of...
- 7
- 307
- 0
báo cáo hóa học:" Rupture of the ilio-psoas tendon after a total hip arthroplasty: an unusual cause of radio-lucency of the lesser trochanter simulating a malignancy" pot
Ngày tải lên :
20/06/2014, 04:20
... neuropathies after total hip arthroplasty Acta Orthop Scand 1980, 51:531-4 19 Wooten SL, McLaughlin RE: Iliacus hematoma and subsequent femoral nerve palsy after penetration of the medical acetabular wall ... pelvis, and low demand of our patient, he was treated by physiotherapy and gait training At four years follow-up and almost 10 years after his THA, he still uses a cane for outdoor ambulation Otherwise ... Hamzaoglu A: Femoral nerve palsy due to iliacus hematoma occurred after primary total hip arthroplasty Arch Orthop Trauma Surg 2008, 128:657-60 18 Solheim LF, Hagen R: Femoral and sciatic neuropathies...
- 5
- 265
- 0
Báo cáo hóa học: " Diagnostic evaluation of three cardiac software packages using a consecutive group of patients" docx
Ngày tải lên :
20/06/2014, 23:20
... software packages in clinical routine and we therefore used the same normal databases that are available to other users of the software packages Page of The custom normal database used by Wolak et al ... software packages In order to mimic the clinical routine of a European MPS clinic, we evaluated the three software packages with their American normal databases and a gold standard based on a ... Acampa W, Berman DS, Germano G: Quantitative myocardial-perfusion SPECT Comparison of three state -of- the-art software packages J Nucl Cardiol 2008, 15:27-34 Guner LA, Karabacak NI, Cakir T, Akdemir...
- 7
- 367
- 0
