a golden age for the arts

Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

Ngày tải lên : 13/08/2014, 16:21
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 3 2 1 ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
  • 9
  • 372
  • 0
huber & robertson - creating new money; a monetary reform for the information age (2000)

huber & robertson - creating new money; a monetary reform for the information age (2000)

Ngày tải lên : 01/11/2014, 23:02
... seigniorage reform might be at a disadvantage in international financial affairs Again, examination shows that the advantages of reform are likely to outweigh any disadvantages in that respect Moreover, ... necessarily connected with banking and financial affairs; the banking industry itself, the central banks, and other national and international monetary and banking institutions; A Monetary Reform for ... so the central bank will manage them for the banks A bank’s own money will exist either as cash in the bank’s till or as noncash money in its operational account with the central bank When banks...
  • 107
  • 183
  • 0
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI   by   Dinh Huu Son

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

Ngày tải lên : 07/04/2013, 23:51
... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... permanently It has another advantage to attract tourists It is the location advantage Due to the fact that there is only international airport, which is Noibai airport, in the North of Vietnam ... creating and managing Web sites and pages Because it incorporates all of Dreamweaver's page design and site management tools, UltraDev makes it easy to create, manage, and edit cross-platform, cross-browser...
  • 58
  • 472
  • 0
Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Ngày tải lên : 15/12/2013, 03:15
... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... Addition:When adding two complex numbers, the real parts and imaginary parts are added separately, the real parts added to real parts and the imaginary to imaginary parts Thus, Copyright 2004, Industrial ... a0 = a – b = ( a – b ) ( a + ab + b ) a2 – b2 = ( a + b ) ( a – b ) ( a + b ) = a + 3a b + 3ab + b a a 3 3 3 a – b = ( a – b ) + 3ab ( a – b ) a a = a 2 a + b = ( a + b ) – 3ab ( a + b ) a b...
  • 3.3K
  • 636
  • 2
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Ngày tải lên : 23/01/2014, 07:20
... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... the need for realism, it is imperative to maintain a reasonable performance for the VR application Here "performance" refers to the response of the virtual environment to the user's actions For...
  • 10
  • 634
  • 1
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Ngày tải lên : 14/02/2014, 13:20
... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local, regional, national...
  • 22
  • 703
  • 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Ngày tải lên : 16/02/2014, 06:20
... A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved in [KSb] that on a certain ... same distribution at the space-time point (x + y, t + s) as the full-space process (started at (0, 0)) at the point (y, s) Again we shall use the same random walk paths A for all the full-state ... constant whose value remains the same throughout this paper (a. s is an abbreviation of almost surely) Acknowledgement The research for this paper was started during a stay by H Kesten at the Mittag-Leffler...
  • 67
  • 490
  • 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Ngày tải lên : 16/02/2014, 22:20
... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria are plant-cells, they must imbibe[Pg 6] their ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...
  • 201
  • 540
  • 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Ngày tải lên : 18/02/2014, 01:20
... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... difficult to obtain Recent advances in the coverage and accessibility of national data on employment and the ability to link these data to higher-education databases are starting to alleviate this condition...
  • 140
  • 391
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20
... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.")...
  • 14
  • 780
  • 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Ngày tải lên : 19/02/2014, 05:20
... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described above Confocal microscopy and imaging...
  • 14
  • 669
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Ngày tải lên : 19/02/2014, 06:20
... 487–495 35 Nakajima O, Takahashi S, Harigae H, Furuyama K, Hayashi N, Sassa S & Yamamoto M (1999) Heme deficiency in erythroid lineage causes differentiation arrest and cytoplasmic iron overload EMBO ... cultured pig alveolar macrophages Arch Biochem Biophys 188, 243–250 43 Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, Sasaki H & Shibahara S (1996) Regulation of human heme oxygenase-1 gene ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
  • 12
  • 621
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Ngày tải lên : 19/02/2014, 16:20
... equal, canceling the negative subgraph with a positive graph of the same absolute value (see below for an example) Therefore, only damped oscillations can be obtained in such a case Additional ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...
  • 11
  • 638
  • 0
140 CHARACTERS A Style Guide for the Short Form

140 CHARACTERS A Style Guide for the Short Form

Ngày tải lên : 19/02/2014, 21:22
... Minimize adverbs and articles Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also ... been operational for more than a year when management decided to create an account to represent the company itself It became apparent that a single account to transmit information to users was needed ... Web-based It was created on March 21, 2006 His message, and the first messages of the other joiners, was automated by the system .The first truly substantive message was prompted by hand: waiting for...
  • 210
  • 3.1K
  • 0
Time Banks A radical manifesto for the UK ppt

Time Banks A radical manifesto for the UK ppt

Ngày tải lên : 06/03/2014, 10:20
... Time Banks UK and their partners at the TimeBank campaign, and the idea has been hailed as a vital tool for rebuilding trust and social capital Community time banks are widely regarded as a neat ... deep-seated social problems That is why policy-makers in Japan and China have adopted time banks so enthusiastically as a way of providing mutual support for their rapidly ageing populations, and ... depression – because they find that taking part in the time bank can mean real improvements The South London and Maudsley NHS Trust covers the same area specialising in mental health, and have watched...
  • 18
  • 317
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20
... the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage product of the Ab A4 precursor protein (APP) ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid...
  • 9
  • 634
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20
... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... l-gulono-1,4-lactone [17] as substrates d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbic acid [14,18] Like yeasts, a protozoan parasite Trypanosoma brucei possesses a d-arabinono-1,4-lactone...
  • 11
  • 571
  • 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Ngày tải lên : 15/03/2014, 10:20
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... area where bank …nancing is the predominant means of …nancing for non-…nancial corporations For example, by the end of 2007 bank loans to the private sector In the euro area banking sector balance...
  • 30
  • 911
  • 0
Báo cáo khoa học: "A Formula Finder for the Automatic Synthesis of Translation Algorithms" docx

Báo cáo khoa học: "A Formula Finder for the Automatic Synthesis of Translation Algorithms" docx

Ngày tải lên : 16/03/2014, 19:20
... in the formula; the machine will use only those variables that are actually required A THE AUTOMATIC SPECIFICATION OF VARIABLES AND EVALUATION OF FORMULAS Variables in the determiner formula and ... specification of variables, and the automatic evaluation of formulas The proposed formula finder and trial translator systems are compatible; the former enables the semiautomatic derivation of basic ... Automatic Language Translation, Doctoral Thesis, Harvard University (1959) Giuliano, V E., and Oettinger, A G., “Research in Automatic Translation at the Harvard Computation Laboratory,” to appear...
  • 14
  • 432
  • 0