a firm must conduct its business with due skill care and diligence
Báo cáo khoa học: Utp25p, a nucleolar Saccharomyces cerevisiae protein, interacts with U3 snoRNP subunits and affects processing of the 35S pre-rRNA docx
Ngày tải lên :
22/03/2014, 21:21
... Uso Animal and follow NIH guidelines Antiserum was isolated through centrifugation, and tested against purified His6–Utp25 and total yeast extract Yeast maintenance, transformation and sporulation ... translation and mRNA stability A short upstream open reading frame strongly inhibits translational initiation and greatly accelerates mRNA degradation in the yeast Saccharomyces cerevisiae J Biol ... analyses Oligo Sequence Ref P1 P2 P3 P4 P5 P6 P7 P8 anti-U3 5¢-GGTCTCTCTGCTGCCGGAAATG-3¢ 5¢-CATGGCTTAATCTTTGAGAC-3¢ 5¢-GCTCTCATGCTCTTGCCAAAAC-3¢ 5¢-CGTATCGCATTTCGCTGCGTTC-3¢ 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢...
- 15
- 328
- 0
Báo cáo khoa học: Aptamers toEscherichia colicore RNA polymerase that sense its interaction with rifampicin, r-subunit and GreB ppt
Ngày tải lên :
23/03/2014, 13:20
... DNA duplex and an 8-nt-long RNA–DNA heteroduplex separated by two unpaired DNA bases (Fig 1A) Unlike the aptamers, MS bound both Eco and Taq core RNAPs with comparable affinities (with a Kd value ... RNAP and stabilize alternative structural states of the enzyme could open the way for a better understanding of the conformational flexibility of RNAP Aptamers are synthetic RNA and ssDNA ligands ... ethanol precipitated, dissolved in water and amplified using Vent DNA polymerase (New England BioLabs) and primers corresponding to fixed regions of the initial library (5¢-GGGAGCTCAGAATAAACGCTCAA-3¢...
- 11
- 303
- 0
Báo cáo y học: "A 64-year old man presenting with carotid artery occlusion and corticobasal syndrome: a case report" pps
Ngày tải lên :
10/08/2014, 23:22
... vascular lesions in the left hemisphere and notable atrophy of mainly the left parietal and frontal cortex (Figure 1) We started prophylactic treatment with aspirin, dipyridamole and simvastatin ... our case is remarkable for the fact that it is associated with marked frontoparietal atrophy on brain imaging, therefore also mimicking the characteristic MRI appearance It is likely that multiple ... this article as: Engelen et al.: A 64-year old man presenting with carotid artery occlusion and corticobasal syndrome: a case report Journal of Medical Case Reports 2011 5:357 • No space constraints...
- 3
- 277
- 0
Báo cáo y học: "Relationship of family caregiver burden with quality of care and psychopathology in a sample of Arab subjects with schizophrenia" pptx
Ngày tải lên :
11/08/2014, 16:22
... roles in data collection: Drs A. S Elshazli, M .A Basiouny, and M .A Hamoda Ms Ramani Varghese played invaluable roles in data analysis and literature search Dr AW Awadalla assisted in translating the ... 0.045) Correlation with quality of care and psychopathology (Table 3) In Pearson’s correlation analyses, with indices of patient’s quality of care and psychopathology as independent variables, the ... IEQ43) and included it as a dependent variable The Cronbach’s alpha for these 26 items was 0.93 We emphasize that all the subscale and total score comparisons with the international data were based...
- 11
- 385
- 0
Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot
Ngày tải lên :
14/08/2014, 08:21
... Isabela Ribeiro: isa.ribeirolucas@gmail.com Diana C Parra: dparra@gwbmail.wustl.edu Adriano A F Hino: manaca@yahoo.com.br Pedro C Hallal: prchallal@gmail.com Deborah C Malta: deborah.malta@saude.gov.br ... low air quality and lack of parks, sidewalks and sports and recreation facilities Changes in the environment can encourage people to be more physically active[11] and many environmental variables, ... educational status and better perceived health in all cities and with lack of nearby sidewalks in the city of Vitória and in the combined data No associations were found with sex, marital status,...
- 20
- 183
- 0
Báo cáo y học: " The Western Norway mental health interface study: a controlled intervention trial on referral letters between Primary Care and Specialist Mental Health Care" pptx
Ngày tải lên :
11/08/2014, 16:20
... dimensions in quality of care (17) Research shows promising results on the effects on patient care and the organization of the care in surgical and medical care when Care Pathways are applied (17-19) ... the patient, professional (mental health nurses and GPs in Primary Health Care and psychiatrists and psychologist in Specialised Mental Health Care) and management perspectives will be conducted ... health -care organizations International Journal of Care Pathways 2010;14(4):143-9 24 Vanhaecht K, Bollmann M, Bower K, Gallagher C, Gardini A, Guezo J, et al: Prevalence and use of clinical pathways...
- 21
- 227
- 0
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
Ngày tải lên :
23/03/2014, 09:20
... vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants ... and are practically nontoxic to insects [1]; (b) a- toxins highly active on insects that bind with high afnity to insect Navs and are weakly toxic in mammalian brain; and (c) a- like toxins that...
- 14
- 206
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
Ngày tải lên :
23/03/2014, 10:21
... GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) BglII- and SalI-digested mutant ... generated by PCR as described above with the same sense oligonucleotide and an antisense oligonucleotide containing an SstI site 5¢-AT GCACACACGTAAGGCACTCAGCTGAGATCTCGAG3¢ The BamHI–KpnI and BamHI–SstI ... 5¢-GGAATT HIC1 interacts with CtBP CGGGATCCCAAAGTACTGCCACCTGCGG-3¢ with a BamH1 site, and antisense 5¢-AGTGGTACCGTCGACTC ATCCCGGGCTGCCGCT-3¢, with a KpnI site The Gal4HIC1 135–422 wt and L22 5A were...
- 12
- 326
- 0
A quick guide to attracting more business with mobile apps potx
Ngày tải lên :
24/03/2014, 00:20
... marketing and engagement tool Find out How! Chapter 2: Have A Business, Build An App Learn how and why your local business needs an interactive and engaging mobile app! Chapter 3: Apptract Customers Apps ... are also a great way to advertise or talk about promotional campaigns and special announcements and send across the message to your target customers For instance, if a business is announcing a ... programs through mobile apps They are a great way to make the customer feel more valued and reward him/her for doing business with you No matter which business you are in, you can adapt and adopt...
- 19
- 335
- 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
Ngày tải lên :
30/03/2014, 04:20
... 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), respectively, ... Assignment of subunits E and H in A- ATP synthase S Gayen et al Low-resolution structures of the enzyme show that the A1 ATPase is rather elongated, with an A3 :B3 headpiece and an elongated ... its amino acid sequence The ratio (h222 ⁄ h208) of molar ellipticity values at 222 and 208 nm was calculated to be 0.95, indicating that a- helical regions within E1–100 are closely packed and are...
- 10
- 351
- 0
terterov marat. doing business with ukraine. a guide to investment opportunities & business practice. 2005
Ngày tải lên :
04/06/2014, 17:32
... Ukrainian law newspaper that conducts an annual survey of opinion of the leading companies and law firms in Ukraine on Ukrainian law firms) The firm has a general corporate and litigation practice, ... practice, and is particularly known for major transactions that it has handled in the real estate, construction, energy and financial sectors, among other areas It has always had a leading tax planning ... assignments, and documenting agreements; and providing legal opinions and advice and practical business approaches regarding Ukrainian corporate law, property law, banking, insurance and finance...
- 501
- 396
- 0
Organization and Development of Russian Business A Firm-Level Analysis_1 potx
Ngày tải lên :
20/06/2014, 23:20
... membership significantly increases the chances to obtain financial and organizational support from the state and, thus, is a rational strategy of market players In Chapter 12, we analyze the influence ... procurement plans Physical demand was also a matter of certain importance This demand was taken into account in the compilation of a plan for the next term, but the compilation was also affected by many ... denotes a law of the Russian Soviet Federative Socialist Republic All laws adopted or enacted in 1992 onward are laws of the Russian Federation b A: Market and trade liberalization, B: Privatization...
- 23
- 335
- 0
Organization and Development of Russian Business A Firm-Level Analysis_2 pdf
Ngày tải lên :
20/06/2014, 23:20
... optimal for business development, with about 18% wanting an increase and only 13% wanting a decrease A vast majority of respondents (over 87%) asserted that their company already had an owner (coalition ... regional and municipal authorities In companies in which public agencies are among shareholders, federal agencies hold an average of approximately 40% of shares, while regional and local authorities ... concentration was approximately the same in manufacturing and communications and was not dependent on company size, type of incorporation, corporate background, and lack of international or domestic...
- 23
- 267
- 0
Organization and Development of Russian Business A Firm-Level Analysis_3 docx
Ngày tải lên :
20/06/2014, 23:20
... Nevada and Delaware and to 50 in Georgia and Wisconsin), as in Russia.3 This suggests that the Russian company law had broken away from the tradition of continental law and boldly incorporated ... of shares owned by a manager or a group of managers or the additional benefits the manager obtains by operating a closed company All three variables concerning capital demand and supply are expected ... comparative advantage 31.2 Share (%) 235 No of affirmative respondents All companies Comparative advantages of open and closed companies over an alternative corporate form of joint-stock company...
- 23
- 262
- 0
Organization and Development of Russian Business A Firm-Level Analysis_4 pptx
Ngày tải lên :
20/06/2014, 23:20
... other hand, the result that a large management shareholder dummy (MANSHA) is significant and positive illustrates a special characteristic of the Russian economy This implies that Russian managers ... orientation among managers toward closed corporate organization due to the underdeveloped capital and managerial markets; (c) slumping needs for corporate finance; and (d) insufficient financial support ... Kanda, H., & Rock, E B (2004) The Anatomy of Corporate Law: A Comparative and Functional Approach (New York: Oxford University Press) Lind, D A. , Marchal, W G., & Wathen, S A (2004) Statistical...
- 23
- 326
- 0
Organization and Development of Russian Business A Firm-Level Analysis_6 pdf
Ngày tải lên :
20/06/2014, 23:20
... such as Japan, CEOs or company presidents are not as powerful and accountable as their American counterparts Rather, they are regarded as a key member of the management team in their company In ... to100.0% c A dichotomous variable with a value of if the company has a dominant shareholder d A dichotomous variable with a value of if the company is operated as an open joint-stock company e Changes ... and for declined) We take the industrial medians of the variable and subtract the company level variable CG: As independent variables of the governance mechanism, we adapt two ownership variables...
- 23
- 213
- 0
Organization and Development of Russian Business A Firm-Level Analysis_7 pot
Ngày tải lên :
20/06/2014, 23:20
... comments and suggestions Special thanks are given to Olga Uvarova for her assistance with data processing and manuscript preparation Notes The newspaper monitors job dismissals and appointments at large ... hand, in the last decade, a tendency toward the separation of ownership and management has become more and more noticeable, and the old Soviet-style managerial teams are being substituted by a ... develop a new business model, form a new appropriate management team, and start modernization As far as the correlation with the changes of managers at the middle level is concerned, we revealed a...
- 23
- 304
- 0
Organization and Development of Russian Business A Firm-Level Analysis_10 docx
Ngày tải lên :
20/06/2014, 23:20
... lack of reliability and distortion in financial data suggests that use of different financial and operational performance indicators would provide for greater accuracy Survey results and annual ... Tatiana Dolgopyatova, Victoria Golikova, Satoshi Mizobata, Heiko Pleines, Fumikazu Sugiura, and Andrei Yakovlev as well as participants of the Joint Workshop of Japan Association of Comparative Economic ... this research Special thanks are due to Olga Uvarova and Leonid Levin for their valuable assistance in data processing Notes In our survey, a typical member of a BG is also a larger participant in...
- 23
- 286
- 0
Organization and Development of Russian Business A Firm-Level Analysis_11 pot
Ngày tải lên :
20/06/2014, 23:20
... and early 2000, and local banks, after 2000 Among those firms having no designated main banks, Sberbank was also involved in a relatively high proportion Bearing these general qualitative characteristics ... their valuable comments My thanks are also due to Eiichi Watanabe for his assistance in translation and Tomiko Noguchi for her assistance in collecting and sorting data Notes The financial sector ... the same data, found that low-level bureaucratic corruption and excessive state regulations facilitate the formation of business associations, that is, a decision to join an association is a rational...
- 23
- 253
- 0
Organization and Development of Russian Business A Firm-Level Analysis_13 pptx
Ngày tải lên :
20/06/2014, 23:20
... the negative in the nearest future Acknowledgments I would like to thank my colleagues Tatiana Dolgopyatova, Larisa Gorbatova, Ichiro Iwasaki and Anna Lukyanova, as well as Lev Freinkman, Daniel ... companies, and the FTSE/ISS scorecard, based on evaluations of financial analysts However, such ratings and scorecards are generally applicable to public companies that are traded on stock exchanges ... demonstrated that, after acquiring a controlling stake, a dominant shareholder got incentives to restructure and develop the company business and found real means to be in command of its managerial...
- 23
- 195
- 0