a firm makes its actual profits in foreign exchange markets

A study on language of advertisements in foreign newspapers

A study on language of advertisements in foreign newspapers

Ngày tải lên : 19/03/2014, 17:07
... phrases in English print advertising have two unusual features: its ability to operate as an independent clause in all areas of an advertisement - headline, subhead, signature line and text - and ... The Germanic languages; The Indo-Iranian languages, including Hindi and Sanskrit; The Slavic languages; The Baltic languages of Latvian and Lithuanian (but not Estonian); The Celtic languages; ... main text of the advertisements Some advertisements may take a minimalist approach, a line, two, or a single paragraph Other advertisements may be quite text-heavy with paragraphs of information,...
  • 73
  • 503
  • 2
International Accounting Standard 21 The Effects of Changes in Foreign Exchange Rates potx

International Accounting Standard 21 The Effects of Changes in Foreign Exchange Rates potx

Ngày tải lên : 06/03/2014, 15:21
... translated in accordance with paragraphs 38–50 19 This Standard also permits a stand-alone entity preparing financial statements or an entity preparing separate financial statements in accordance ... recognition in accordance with International Financial Reporting Standards For practical reasons, a rate that approximates the actual rate at the date of the transaction is often used, for example, an average ... restating its financial statements Translation of a foreign operation 44 Paragraphs 45–47, in addition to paragraphs 38–43, apply when the results and financial position of a foreign operation are...
  • 10
  • 523
  • 1
foreign exchange markets

foreign exchange markets

Ngày tải lên : 11/09/2014, 22:02
... Travel abroad more expensive  Harder for Indian firms to expand into foreign markets Foreign Exchange _ 24 Foreign exchange markets Arbitrage and hedging  Exchange arbitrage involves taking advantage ... and to trade currencies back again later, both at prices agreed at the beginning Foreign Exchange _ Foreign exchange Foreign exchange quotations  Exchange rate is the price of one currency in ... advantage of differences in international interest rates to get a higher return  Subject to exchange rate risk Foreign Exchange _ 25 Foreign exchange markets Arbitrage and hedging  Hedging involves...
  • 29
  • 265
  • 0
foreign exchange markets

foreign exchange markets

Ngày tải lên : 12/09/2014, 01:00
... Travel abroad more expensive  Harder for Indian firms to expand into foreign markets Foreign Exchange _ 24 Foreign exchange markets Arbitrage and hedging  Exchange arbitrage involves taking advantage ... and to trade currencies back again later, both at prices agreed at the beginning Foreign Exchange _ Foreign exchange Foreign exchange quotations  Exchange rate is the price of one currency in ... advantage of differences in international interest rates to get a higher return  Subject to exchange rate risk Foreign Exchange _ 25 Foreign exchange markets Arbitrage and hedging  Hedging involves...
  • 29
  • 277
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Ngày tải lên : 15/02/2014, 01:20
... used in this study are shown in Table S1 Construction of bacterial strains Initially, an unmarked deletion was generated in nirF in a wild-type GB17 P pantotrophus strain This was performed in a ... Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans Antonie Leeuwenhoek 66, 111–127 13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997) ... sequences, notably for two strains of Ps aeruginosa, PA7 and PAO1, but also that in Magnetospirillum magneticum, not have any readily recognizable, i.e N-terminal positive charges, central hydrophobic...
  • 12
  • 613
  • 0
Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

Ngày tải lên : 21/02/2014, 01:20
... University, Cambridge, MA Balasubramanyam, V.N., and V Mahambare (2003) FDI in India Transnational Corporations 12 (2): 45-72 Balasubramanyam, V.N., M .A Salisu and D Sapsford (1996) Foreign Direct Investment ... appears that it was mainly the manufacturing sector that benefited from trade liberalization, financial liberalization and human capital formation in post-reform India and the complementary process ... indices are available only for some industries that are comparable to industry-specific FDI data The Database on Indian Economy also offers output data in constant prices (originating from India's...
  • 45
  • 513
  • 0
corporate social responsibility in viet nam a study of its importance for vietnamese investors

corporate social responsibility in viet nam a study of its importance for vietnamese investors

Ngày tải lên : 13/03/2014, 14:20
... 12 contaminated milk in Vietnam, people are scared of using that product Recently, a Taiwanese-owned company in Quang Minh industrial zone near Ha Noi has been found discharging waste water directly ... using the disciplines of finance, communication and marketing to manage the content and flow of company information to financial and other constituencies to maximize relative valuation” NIRI as ... profession investor relations body defines its main reason for existence is to maintain the firm s fair relative market value With that approach, the role of investor relations has been focus on the firm...
  • 64
  • 735
  • 0
corporate social responsibility in vietnam; a study of its importance

corporate social responsibility in vietnam; a study of its importance

Ngày tải lên : 13/03/2014, 14:20
... misunderstanding 26 CHATER 4: FINDINGS AND ANALYSIS 4.1 Findings As mention above, survey questions are done in patterns: management, customer and accounting Participants are managers, customers and accounting ... negative campaign and upgrading the company image Third, companies may use reporting as internal communications, educating and motivating employees In responding to a growing demand for socially ... limiting the needed information, classification the finding information, analyst information, and the final stage is to evaluate the finding information in order to meet the requirements of each...
  • 68
  • 645
  • 0
social accounting in vietnam a study of its importance

social accounting in vietnam a study of its importance

Ngày tải lên : 13/03/2014, 14:20
... Priorities Accreditation Agency – USA) currently known as Social Accountability International (SAI) The SA 8000 standard is an internationally auditable performance standard relying on International Labor ... could be adopted to increase the return on financial capital Last, sustainability accounting may exist to highlight organizational practices and to provide a catalyst for change initiated within (for ... Vietnamese accounting standard or any documentary to guide social accounting application; whereas most multinational companies use social accounting system and reports at the same time with financial accounting...
  • 63
  • 392
  • 1
Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot

Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot

Ngày tải lên : 23/03/2014, 16:20
... word phrase on latent dirichlet allocation Forum on Data Engineering and Information Management,i-6 Yee W Teh, David Newman, and Max Welling 2006 A Collapsed Variational Bayesian Inference Algorithm ... Thomas K Landauer, and Richard Harshman 1990 Indexing by Latent Semantic Analysis Journal of the American Society of Information Science, 41(6):391– 407 Shotaro Matsumoto, Hiroya Takamura, and Manabu ... Computational Linguistics:294–301 Anastasios Tombros and Mark Sanderson 1998 Advantages of query biased summaries in information retrieval In Proceedings of the 21st Annual International ACM-SIGIR...
  • 6
  • 397
  • 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Ngày tải lên : 18/06/2014, 18:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx ... contains 233 upstream nucleotides (p23 3A1 2L) To place A1 2L ORF in both pRB21 and TOPO vector, two different sets of primers were designed; pA12Lforward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and...
  • 6
  • 397
  • 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Ngày tải lên : 20/06/2014, 01:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx ... contains 233 upstream nucleotides (p23 3A1 2L) To place A1 2L ORF in both pRB21 and TOPO vector, two different sets of primers were designed; pA12Lforward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and...
  • 6
  • 401
  • 0
Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

Ngày tải lên : 07/08/2014, 10:21
... important measures compensating the environment contamination by extraneous substances are preventive measures that can be applied on a larger part of the area of endangered forest ecosystems According ... The mathematical formulation of the production system behaviour (in logging and transport operations, but also valid for silvicultural operations) shown in this paper has confirmed that it can ... Dias A. C., Arroja L., Capela I., 2007 Carbon dioxide emissions from forest operations in Portuguese eucalypt and maritime pine stands Scandinavian Journal of Forest Research, 22: 422–432 Duvigneaud...
  • 6
  • 341
  • 0
Báo cáo y học: "Structural valve deterioration of a mitral Carpentier-Edwards pericardial bioprosthesis in an 87-year-old woman 16 years after its implantation" doc

Báo cáo y học: "Structural valve deterioration of a mitral Carpentier-Edwards pericardial bioprosthesis in an 87-year-old woman 16 years after its implantation" doc

Ngày tải lên : 10/08/2014, 09:21
... heart valve ASAIO J 2004, 50:606-10 Kubota S, Wakasa S, Ooka T, Tachibana T, Shinya N, Matsui Y: A case of Carpentier-Edwards pericardial bioprosthesis in mitral position explanted 22 years after ... Japanese is quite long, being 79.59 years in males and 86.44 years in females, and the average expected length of life at 70 years is 15.1 years in males and 19.61 years in females (Japan Ministry ... this article as: Ito et al.: Structural valve deterioration of a mitral Carpentier-Edwards pericardial bioprosthesis in an 87-year-old woman 16 years after its implantation Journal of Cardiothoracic...
  • 3
  • 268
  • 0
Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

Ngày tải lên : 11/08/2014, 08:20
... (p21_sense_SalI 5'-TCG AGC CGT CAG GAA CAT GTC CCA ACA TGT TGA GCT G-3' and p21_anti_XbaI 5'-CTA GCA GCT CAA CAT GTT GGG ACA TGT TCC TGA CGG C-3') into the XbaI and SalI sites of the vector backbone ... β-galactosidase assay to measure activation of the lacZ reporter gene Wild type p53 and the indicated point mutant variants were transformed into the p53 responsive reporter strain and β-galactosidase ... should be suitable to assess DNA-binding and transcriptional activation activity regardless of posttranslational modifications and other influences that are inevitable when p53 is studied in the context...
  • 9
  • 485
  • 0
the management of foreign exchange rate regime in a market-oriented economy

the management of foreign exchange rate regime in a market-oriented economy

Ngày tải lên : 04/12/2014, 08:49
... parallel exchange rate or black market exchange rate The official exchange rate also has several types: the interbank exchange rate, exchange rate of commercial banks, accounting exchange rates ... from a stable exchange rate against the benefits of exchange rate flexibility as a shock absorber in the presence of nominal rigidities Since stable exchange rates increase trade gains, pegs are ... Vietnam is the dual exchange rate regime Even though State Bank actually apply a single official rate for all commercial transactions on a national scale, but the unofficial market exchange rate...
  • 67
  • 460
  • 1
garcia-blandon et al - 2014 - audit firm tenure and audit qualifications in spain - a multinomial approach [mafr]

garcia-blandon et al - 2014 - audit firm tenure and audit qualifications in spain - a multinomial approach [mafr]

Ngày tải lên : 06/01/2015, 19:42
... audit qualifications into a single variable could cause misleading results Audit regulation in Spain With the main goals of enhancing transparency and making financial statements more comparable ... caused its eventual withdrawal Finally, mandatory rotation was 98 J Garcia-Blandon, J.M Argiles & M Martinez-Blasco: Audit firm tenure and audit qualifications in Spain: a multinomial approach limited ... of audit qualifications 102 J Garcia-Blandon, J.M Argiles & M Martinez-Blasco: Audit firm tenure and audit qualifications in Spain: a multinomial approach 4.2 Sample and dataset Empirical analysis...
  • 28
  • 288
  • 0
Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

Ngày tải lên : 24/06/2015, 08:16
... or rural Greece and much of Africa, Asia, and Latin America (Triandis [2]) Individualistic cultures structure social experience around autonomous individuals In an individualistic culture, individuals ... enhance learning 2) Students pay much attention to grammar, vocabulary, and reading They are not active in class and the main purpose they are in class is only to listen They are not willing ... regarding culture of teaching in EFL contexts is the focus on grammar translation in the examination system In Vietnam, curriculum and exams are still grammar-based Therefore, teachers are greatly...
  • 10
  • 544
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 2

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 2

Ngày tải lên : 11/09/2015, 09:07
... (cADPRE) and intracellular Ca2+-releasing activity of cADPR (cADPRI) on responsive stores (Adapted from Zocchi et al., 1993) cADPRE- extracellular cADPR cADPRI- intracellular cADPR 93 Chapter Characterization ... dynamic internalization is a much slower process in cellular signaling The group proposed that instead of serving as the key step in triggering intracellular signaling, the internalization step may ... internalization might represent an alternative mechanism of intracellular signaling unrelated to its enzymatic properties and the Ca2+-releasing properties of cADPR The data showed that the dynamic...
  • 59
  • 280
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 3

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 3

Ngày tải lên : 11/09/2015, 09:08
... with ADPR is potent Ca2+ releasing agent involved in many signaling pathways leading to apoptosis or necrosis (refer to review by Chini, 2009) as well as a role as a substrate and regulator of ... modulate Ca2+ homeostasis by affecting IP3-gated Ca2+ channels, mitochondrial permeability transition (mPTP) and RyR NAADP generated from NADP can also mobilize intracellular NAADPdependent Ca2+stores ... intracellular Ca2+ signaling pathway involving mitochondria 180 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A) ) kDa 75 50 37 25 mtHSP70 C) + NAD glycohydrolase Activity...
  • 35
  • 174
  • 0