a fax machine is used to send and receive letters and pictures quickly

Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf

Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf

Ngày tải lên : 21/12/2013, 19:15
... mechanism for the interface to simulate an active state for internal processes, such as routing, on the router The show interface command can also be used to display information about the B channel: ... configurations g Use the show dialer command to see the reason for the call This information is shown for each channel: Tokyo#show dialer h Which dialer strings are associated with Dialer1? ... Sydney(config-if)#dialer string 5551001 Step Associate dialer profiles a Finally, associate the Dialer Profiles with the Dialer Interfaces that will be used, when needed Create a Dialer Pool, and put the interfaces...
  • 8
  • 419
  • 0
Tài liệu She is used to getting up late in cold weather pot

Tài liệu She is used to getting up late in cold weather pot

Ngày tải lên : 26/02/2014, 00:20
... câu - is used to getting up late” - quen với việc dậy trễ Đây động từ (verb) câu Trong is used to trợ động từ (auxiliary) “getting up” động từ câu (main verb) Cấu trúc câu to be used to + V-ing” ... *She is used to getting up late in cold weather Hình thức ngữ pháp : Cấu trúc câu "to be used to + V-ing " (Thói quen tại) Chúng ta quan sát câu sau Các bạn di chuột vào từ ... biết thêm chi tiết từ đó) She is used to getting up late in cold weather 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She is used to getting up late in cold weather 3 Tại câu lại dịch vậy?...
  • 5
  • 703
  • 0
A glossary of terms used in payments and settlement systems pot

A glossary of terms used in payments and settlement systems pot

Ngày tải lên : 15/03/2014, 10:20
... Blue Book MAC message authentication code: a hash algorithm parameterised with a key to generate a number which is attached to the message and is used to authenticate it and to guarantee the integrity ... transferor ISO International Organization for Standardization: an international body whose members are national standards bodies and which approves, develops and publishes international standards ... data encryption standard digital signature a string of data generated by a cryptographic method that is attached to a message to ensure its authenticity as well as to protect the recipient against...
  • 53
  • 520
  • 0
How Is Deployment to Iraq and Afghanistan Affecting U.S. Service Members and Their Families potx

How Is Deployment to Iraq and Afghanistan Affecting U.S. Service Members and Their Families potx

Ngày tải lên : 23/03/2014, 08:20
... and Performance, A Review of the Literature and Its Applicability to the Military Stress has always been a reality of warfare, and the wars in Iraq and Afghanistan have been no exception In a ... reenlistment was about zero in 2003 and tended to increase from 2003 to 2007, years of heavy involvement in Iraq and Afghanistan.2 The cause of this particular trend in the Army appears to be a ... research quality and objectivity Occ a siOn a l Pa Per How is Deployment to iraq and afghanistan affecting U.s service Members and Their Families? an Overview of early ranD research on the Topic...
  • 62
  • 341
  • 0
Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

Ngày tải lên : 30/03/2014, 16:20
... 5¢-CAATGCTGGCAT GAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢, 5¢-AA CTGGACCCTAAGCCTA-3¢ or 5¢-ACTGGATCCTAGGT GATC-3¢ 5¢-RACE was performed using a Marathon cDNA Amplification ... resultant double-stranded cDNA was ligated to a Marathon cDNA adapter by T4 DNA ligase The PCR for 5¢-RACE was performed using the forward primer AP-1: 5¢-CCATCCTAATACGACTCACTAT AGGGC-3¢ and a SLC3 9A1 4-specific ... testis, epidermal white adipose tissue (WAT) and interscapular brown adipose tissue (BAT) isolated from adult male mice by Q-PCR WAT samples were fractionated into stromal-vascular cells and mature...
  • 10
  • 323
  • 0
the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009

Ngày tải lên : 10/06/2014, 21:30
... especially Michael Armato, Stephanie Byrd, Sarah Damaske, Adam Green, Pamela Kaufman, Allen Li, and Louise Roth, also offered valued feedback Over the years they have taught me as much as I taught ... Hannah listened to her mother regularly complain and blame her father—about lost chances and roads not taken: I hear about this ad nauseam! My mother was the first woman in the state to be in agricultural ... sociological imagination”—the intersection of biography, history, and social structure.14 This approach calls on us to investigate how specific social and historical contexts give shape to the transhistorical...
  • 312
  • 381
  • 0
báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

Ngày tải lên : 18/06/2014, 19:20
... of the study, participated in its coordination and the statistical analysis, and helped to draft the manuscript All authors read and approved the final manuscript Additional material http://www.hqlo.com/content/6/1/61 ... translated into Portuguese by professional translators and translated back into German by the accompanying translators The interview was identical to the one given to the Moroccan women Internal ... four pertaining to a monitoring and four to a blunting, i.e distracting style of coping Participants are asked to anticipate each scenario and rate how likely they would engage in each of the...
  • 6
  • 435
  • 0
Semantics  Semantics is the study of meaning that is used to understand human expression through language.

Semantics Semantics is the study of meaning that is used to understand human expression through language.

Ngày tải lên : 13/07/2014, 23:26
... Semantics is the study of meaning that is used to understand human expression through language Semantics is perhaps the most difficult part of the grammar of a language to learn What is “semantics”? ... Another fact dealing with this type is that a small elephant” for example, is much bigger than a big mouse” a Implicitly gradable pairs Another characteristic of certain pairs of gradable antonyms ... Language is arbitrary It is arbitrary because the relationship between forms and their meanings are sometimes can not logically proved Although a form can have more than one meaning, there is...
  • 26
  • 954
  • 2
Báo cáo y học: "Non-invasive neurosensory testing used to diagnose and confirm successful surgical management of lower extremity deep distal posterior compartment syndrome" potx

Báo cáo y học: "Non-invasive neurosensory testing used to diagnose and confirm successful surgical management of lower extremity deep distal posterior compartment syndrome" potx

Ngày tải lên : 10/08/2014, 10:20
... running he began to complain of tightness and a dull aching pain that progressed to severe pain eventually causing him to stop exercising His pain was also associated with paresthesias and numbness ... one and two point static touch and to measure two point discrimination in the skin innervated by medial plantar and medial calcaneal branches of the tibial nerve (Figures and 2) The anterior lateral ... was used during a provocative test to assist in making the diagnosis and then to help guide surgical management of CECS in an athlete The gold standard for diagnosis of CECS is invasive intracompartmental...
  • 6
  • 334
  • 0
Báo cáo y học: "Murine leukemia virus RNA dimerization is coupled to transcription and splicing processes" ppsx

Báo cáo y học: "Murine leukemia virus RNA dimerization is coupled to transcription and splicing processes" ppsx

Ngày tải lên : 13/08/2014, 01:20
... Gag is required for RNA encapsidation in RSV or lentiviral particles [57,58] Acknowledgements We thank laboratory members past and present, including Laurent Houzet, Fatima Smagulova, and Zakia ... sequentially to generate integrations in tandem or in distant loci, respectively (Figure 2AB) After selection, resistant colonies were pooled and RNA extracted from total cell extracts Viral FL and ... from ACI/ANR Authors’ contributions SM and MM conceived the study and analyzed the data SM performed the laboratory work MM wrote the manuscript The authors read and approved the final manuscript...
  • 8
  • 237
  • 0
A survey on students’ attitudes to deductive and inductive approaches to teaching english grammar for grade 11th at bac kan gifted high school

A survey on students’ attitudes to deductive and inductive approaches to teaching english grammar for grade 11th at bac kan gifted high school

Ngày tải lên : 25/10/2016, 09:32
... and Disadvantages of Inductive and Deductive Approaches to English Grammar Teaching 15 1.3.1 Advantages and Disadvantages of Inductive Approach 16 1.3.2 Advantages and Disadvantages ... inductive approach to apply for the sake of learners’ success in the acquisition of a foreign language in general and English language in particular 1.3 Advantages and Disadvantages of Inductive and ... learned in accordance with context can language learners thoroughly understand and master that language Therefore, grammar is seen as a tool to correct language use and polish learners’ language products...
  • 69
  • 784
  • 1
Is complementary and alternative medicine (CAM) used to combat medical costs  a study of consumers, medical professionals, and a CAM practitioner

Is complementary and alternative medicine (CAM) used to combat medical costs a study of consumers, medical professionals, and a CAM practitioner

Ngày tải lên : 03/11/2016, 21:07
... family I want to dedicate this to my parents, grandparents, and great-grandparents for always supporting and encouraging my education Thank you Mom, Dad, Grandma Smith, Grandpa Smith, Grandma ... complementary and alternative medicine (CAM) use CAM refers to a number practices that are meant to address health and healing as a whole and that satisfy health needs that traditional Western ... Culture and capitalism have shaped the way that Americans approach health and healing As discussed previously, health, as concept, can be both a universal and also a culturally-specific term Maslow’s...
  • 125
  • 422
  • 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Ngày tải lên : 20/01/2014, 20:20
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
  • 696
  • 1K
  • 1
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
  • 14
  • 635
  • 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20
... 8–14); a mixture of untreated Ure2p and Ssa1p is seen in lanes and 10 Ure2p, Ssa1p and Ure2p incubated with Ssa1p treated with BS2G are seen in lanes and 8, and 11 and and 13, respectively Similar ... blotted and stained with antibodies directed against Ure2p or His-Tagged Ssa1p (B) (A) A mixture of untreated Ure2p and Ssa1p (lane 1); Ure2p alone (lanes 2, 5, and 11), Ssa1p alone (lanes 3, 6, and ... monomeric Ssa1p and Ure2p–Ssa1p complexes with apparent molecular masses of 120 and 160 kDa were excised Each protein band was subjected to in-gel enzymatic cleavage after reduction and alkylation...
  • 12
  • 510
  • 0
Báo cáo khoa học: "Towards a Unified Approach to Memory- and Statistical-Based Machine Translation" pdf

Báo cáo khoa học: "Towards a Unified Approach to Memory- and Statistical-Based Machine Translation" pdf

Ngày tải lên : 17/03/2014, 07:20
... Cutting-Edge Strategies For Going Multilingual In A Global Age John Benjamins Publishers Tony Veale and Andy Way 1997 Gaijin: A template-based bootstrapping approach to examplebased machine translation ... Machine translation with a stochastic grammatical channel In Proceedings of ACL’98, pages 1408–1414, Montreal, Canada Kenji Yamada and Kevin Knight 2001 A syntaxbased statistical translation model ... are complementary: Vogel and Ney (2000) identify abstract patterns of usage and then use them during translation This may address the data sparseness problem that is characteristic to any statistical...
  • 8
  • 433
  • 0
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

Ngày tải lên : 22/03/2014, 16:21
... stewed tomatoes and unsalted tomato sauce, garlic, basil, and oregano to a saucepan (use a potato masher to mash up stewed tomatoes in the pan) Let simmer Brown the chopped meat and strain any fat, ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation:serve with tomatoes, guacamole, ... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad...
  • 123
  • 392
  • 0