a faithless leap the conspiracy that is already here

Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

Ngày tải lên : 23/03/2014, 07:20

... 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; cdk4-R, 5¢-TGGGCATCGAGACTATAGGG-3¢; rp49-F, 5¢-CGG ATCGATATGCTAAGCTG-3¢; and rp49-R, 5¢-GAACG CAGGCGACCGTTGGGG-3¢ ... reduced the amount of the 250 kDa dJmj protein to an undetectable level at days after dsRNA treatment, whereas that of the 120 kDa band was unchanged throughout dsRNA treatment (Fig 2B, lane 9) Therefore, ... compilation ª 2007 FEBS N Sasai et al catalytically inactive as histone demethylases because of the amino acid changes in the catalytic domain [11,12] Several other JmjC-containing proteins are...

13
356
0

the nothing that is, a natural history of zero - robert kaplan

Ngày tải lên : 05/06/2014, 11:23

... being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s 1031), and so ... estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand But it is made much more spectacular when ... through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 + 46 = 1053) at last But it isn't the last after all: just as with Archimedes, this is a first...

238
5.2K
0

Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx

Ngày tải lên : 09/08/2014, 06:22

... official EULAR journal This now has an impact factor of over and is next only to the ACR journal Arthritis and Rheumatism in its field The submission rate to the Annals is increasing substantially ... presented and discussed, just like all other material presented at the Congress And the satellites could be arranged under the umbrella of the Congress but on separate days The risk with organizing the ... believe the abstract-book-only category is dispensable for the next EULAR Congress This year the program and abstracts were indeed available on the web site before the meeting, although for reasons...

3
296
0

Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Ngày tải lên : 23/03/2014, 10:20

... TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted into the PmaCI site ... obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ ... Designed DNA as an activator of transcription N Sumida et al transient transfection assay system, at a speciﬁc rotational phase and distance between T4 and the promoter [12] We concluded that T4 formed...

12
399
0

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Ngày tải lên : 17/03/2014, 23:20

... is also the most crucial MRE for transcription of the MT gene and that there is a relationship between the distance from each MRE to the TATA box and their inﬂuence on promoter activity of the ... normalized to b-gal activity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in pGLpro transfected cells Data represent the ... increased sensitivity to radiation and diminished DNA repair [58,59], although there are still some arguments in the exact locations of domains in Ku-80 [60–63] Based on the facts that amino acids...

11
628
0

The RAND Corporation is a nonproﬁt research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx

Ngày tải lên : 22/03/2014, 09:20

... financing, and practice at the state and local levels • Advance a family-centered approach to maternal and child health care that (1) establishes a medical or social service home or homes for each family ... Fixsen, and Dunlap, 2003) The data also suggest that solutions to maternal and child health care must address the broader social issues that sustain these disparities in health For example, according ... baby was having an asthma attack? I shoved him under her nose and said, ‘Blue is not a good color for an African-American baby.’” The family has also failed to get help because the agencies they...

79
343
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20

... heteronuclear two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1fi3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus glycopeptides ... glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopeptide side-chain atoms of tx 5a, which ... Chemical shift (p.p.m.) Disaccharide: Gal-GalNAc Proton (1H) GalNAc:H1 GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3.77 3.77 4.82 4.82 3.53 1.79 1.79 1.79 GalNAc:H2...

11
563
0

Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot

Ngày tải lên : 10/08/2014, 09:20

... Mieda M, Williams SC, Richardson JA, Tanaka K, Yanagisawa M: The dorsomedial hypothalamic nucleus as a putative foodentrainable circadian pacemaker Proc Natl Acad Sci USA 2006, 103:12150-12155 Angeles-Castellanos ... temperature rises in anticipation of mealtime at least an hour earlier than this figure suggests The data therefore appear to contradict the stated claim in the paper 2e A critical interpretive issue ... section that differs between the two versions of these data this software Regardless, the fact that a significant misalignment occurred raises concerns about the accuracy of other figures in the paper...

13
349
0

báo cáo khoa học: "The ACR11 encodes a novel type of chloroplastic ACT domain repeat protein that is coordinately expressed with GLN2 in Arabidopsis" pptx

Ngày tải lên : 11/08/2014, 11:21

... GATTCATTGGCTC-3’ and 5’-AGTAGTAGATGAATATATTG-3’; ACR10, 5’-ATAGGAGGAACAACACAAAC-3’ and 5’-TTACTATGAAACCCACACAG-3’; ACR11, 5’-AAAAGGATCCATGGCTATGGCCTCT GCTTC-3’ and 5’-GGGGAGGCCTGAAACTTGACTC GTCAGTTG-3’; ACR12, ... of the start codon) was amplified from the Arabidopsis genomic DNA by PCR using the primers 5’-CACCTCTAGACACTCAAAAATCGGAATTAA-3’ and 5’-AACAAAG CTTATCTCTTGAGTCTGACTCAA-3’ The PCR product was ... bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic...

10
420
0

báo cáo khoa học: " A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold" docx

Ngày tải lên : 11/08/2014, 11:21

... USA) Manipulation of nucleic acids The CTAB method was used to extract Arabidopsis leaf DNA [81], and the Trizol RNA reagent (Invitrogen, CA, USA) was used to extract total leaf RNA RNA gel analysis ... unclear, both ours and other’s genetic data have clearly established a link between VAR2 and chloroplast translation The notion that VAR2 may be directly involved in chloroplast translation is ... in TAG-11 by RT-PCR, suggesting that svr3-1 is a molecular null allele and offering further confirmation that At5g13650 is the suppressor gene Although our data indicate that At5g13650 is disrupted...

18
554
0

báo cáo khoa học: " Debunking the claim that abstinence is usually healthier for smokers than switching to a low-risk alternative, and other observations about anti-tobacco-harm-reduction arguments" potx

Ngày tải lên : 11/08/2014, 18:20

... affect all or random individuals, making this the relevant level of analysis The key to the calculation is the observation that if we assume that smoking more never cures a disease that was caused ... claim, it is often the case that the rough analysis that is practical is quite adequate for present needs, and is a great improvement over unquantified speculation For any given smoker at a particular ... products Analysis It is illustrative to begin this analysis by addressing the assertion that total social (population) risk will increase if THR is embraced, explaining how that is insupportable,...

10
205
0

Báo cáo khoa học: " Proteomics computational analyses suggest that the bornavirus glycoprotein is a class III viral fusion protein (γ penetrene)" pot

Ngày tải lên : 12/08/2014, 04:20

... Carbone KM, Duchala CS, Griffin JW, Kincaid AL, Narayan O: Pathogenesis of Borna disease in rats: evidence that intraaxonal spread is the major route for virus dissemination and the determinant ... by a system of neural networks, and is rated at an expected average accuracy of 72% for three states, helix, strand and loop [36] This algorithm predicts that there is a region that forms an ... Orthomyxoviridae, Retroviridae, Paramyxoviridae, Filoviridae, Arenaviridae, and Coronaviridae and Baculoviridae have members that encode class I VFP [16,22,17-21,45] Flaviviridae, Togaviridae, and Bunyaviridae...

10
335
0

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Tài liệu Báo cáo khoa học: Aggregative organization enhances the DNA end-joining process that is mediated by DNA-dependent protein kinase pdf

Ngày tải lên : 19/02/2014, 06:20

... kinase that is mutated in the human hereditary disease ataxia telangiectasia: induced chromatin alterations relay its intermolecular autophosphorylation and dimer dissociation [10] Over 50% of the ... Aggregation-coupled DNA end-joining M Takahagi and K Tatsumi One hallmark of the initial response to DSBs is the rapid activation of ATM (product of the ataxia telangiectasia mutated gene), the ... view that the DNAPKcs-mediated aggregates stay in a catalytically competent state A further concern is whether the protein kinase activity of DNA-PKcs is really associated with the EJ reaction...

13
458
0

Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

Ngày tải lên : 21/02/2014, 09:20

... outlined above Along the way, we are able to acquaint the reader with the culture of mathematics: who mathematicians are, what they care about, and what they We also give indications of why mathematics ... Experimental Mathematics is published by A K Peters, a daring and innovative mathematics publisher Klaus Peters is himself a Ph.D in mathemat16 There is a grand tradition in mathematics of not leaving ... together It is what makes the subject travel well, and guarantees that mathematical ideas will have some immortality There is no other scientiﬁc or analytical discipline that uses proof as readily...

334
515
0

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Ngày tải lên : 05/03/2014, 17:20

... where it appeared diffuse, not granular (Figs 7B, C, E) Lack of colocalization of LCA and ABL2 on the blastomeres surface at this time supports our data (Fig 1C) that the ABL2 antigen (PAD) is ... were stained by anti-PAD V (N) At the 8-cell stage, anti-PAD V (N) labeling was still associated with the blastomeres' plasma membranes, and the label was diffuse around the blastomeres surface ... In the mammalian PAD family, approximately 50% of the amino acids are identical among different isoforms within one species, and 70% to 95% of the amino acids are identical among the same isoforms...

22
519
0

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Ngày tải lên : 07/03/2014, 09:20

... interaction is only an artifact, it is apparently strong enough to appear in the crystal and adjust the enzyme in an induced-fit-like manner: the conformation of the flap domain changes, M3 metal is ... [ED]-hydrophil-X(1,2)-[ST]-X-P, allows similar interactions to those described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at ... Journal compilation ª 2007 FEBS 3135 Structure of S agalactiae STP M K Rantanen et al Table Structure refinement statistics for SaSTP against the native ˚ P21212 and SAD data SAD data collected at...

10
542
0

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starﬁsh embryogenesis ppt

Ngày tải lên : 08/03/2014, 10:20

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...

11
501
0