a dental home and appropriate dental services are essential to the health of every child
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc
... compliance in another (Monahan, 1995) In health education, individual and cultural differences in health beliefs, perception of and attitude to risk, and level of education are among the factors ... generate an appropriate surface form in English A formatter then lays out the text attractively and adds headings and illustrations for final printing Authoring and Generating Tailored Health- Education ... material, or they may be created from scratch (or some combination of the two) Either alternative requires a human and an authoring tool The creator of a master document would normally be a professional...
- 12
- 379
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of ... Functional and structural characterization of the catalytic domain of the starch synthase III from Arabidopsis thaliana Proteins 70, 31–40 Senoura T, Asao A, Takashima Y, Isono N, Hamada S, Ito H ... Construction of the pNAL1 vector for the expression of CD of SSIII from A thaliana and truncated proteins The plasmid named pVAL3 containing the catalytic C-terminal domain of SSIII (1374 bp) was used as...
- 13
- 457
- 0
A STUDY ON ENGLISH WORDS FORMED BY CONVERSION RELATING TO THE NAMES OF ANIMALS
... to the names of animals Names of animals are familiar with the life of people We observe them and find their characteristics, habits Each of animals has its typical character Basing on typical ... and more new words to name new things and to indicate new ideas Some of these are applied by foreign languages but most of them are homemade People use the words that they have to help make the ... Cows are raised as livestock for meet (beef and veal) as dairy animals for milk and other dairy products and as draft animals In some country, such as India, cows are scared.” (Wikipedia.org/wiki/cow)...
- 71
- 751
- 1
Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt
... 5'-CCGTAGGACTGGAAAGAGGA-3' Page of 13 (page number not for citation purposes) Sense 5'-CATCTTCTCAAAATTCGAG-3' 5'-TGGGAGTAGACAAGGTACAACCC-3' Sense 5'-CAACCAACAAGTGATATTCTCCATG-3' 5'-GATCCACACTCTCCAGCTGCA-3' ... 5'-GATCCACACTCTCCAGCTGCA-3' Sense 5'-CACTTCACAAGTCGGAGGCTTA-3' 5'-GCAAGTGCATCATCGTTGTTG-3' Sense 5'-AGAGGGAAATCGTGCGTGAC-3' Antisense TNFα, tumor necrosis factor alpha 5'-AGGAGGAGCAATGATCTTGATC-3' Antisense ... prepared the human samples of synovial tissues and cells YK performed the quantitative PCR KY supervised the study design and gave valuable advice to HS All authors read and approved the final manuscript...
- 13
- 552
- 0
A STUDY ON USING PHONICS METHOD IN TEACHING PRONUNCIATION TO THE BEGINNERS OF ENGLISH AT TIENGANH123 ENGLISH CENTER
... specific areas of the research context Action: the plan is to put into action over an agree period of time Observation: the effects of the action are observed and data are collected Reflection: the ... is the study of all possible speech sounds The human vocal apparatus can produce a wide range of sounds, but only a small number of them are used in a language to construct all of its words and ... sounds, in the production of which one articulator moves towards another or two articulators come together obstructing the air stream and the air stream can’t get out freely.” According to Marianne,...
- 48
- 848
- 5
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... such as ArcB, BvgS and EvgS As the quinones are the only components of the respiratory chain which apparently are free in their movement within the membrane, they may easily come into close contact ... 3480 A Bock and R Gross (Eur J Biochem 269) kinase ArcB together with the response regulator ArcA regulates the expression of many genes which are involved in the adaptation of the bacteria during...
- 6
- 421
- 0
The Semantic Web: A Guide to the Future of XML, Web Services, and Knowledge Management doc
... Web The path to machine-processable data is to make the data smarter All of the technologies in this book are the foundations What Is the Semantic Web? of a systematic approach to creating “smart ... “semantic algebra.” This allows the combination and recombination of data at a more atomic level and very fine-grained analysis of data Thus, in this stage, data no longer exists as a blob but as ... knowledge and understanding from raw data Many readers were confused by the vision because the nuts and bolts of the Semantic Web are used by machines, agents, and programs and are not tangible to end...
- 304
- 361
- 2
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
... whether a decrease of the angiogenic factors VEGF and bFGF and an increase of the angiostatic factor endostatin contribute to the impaired angiogenesis in patients with SSc, and whether these factors ... not to other factors related to bFGF such as acidic fibroblast growth factor The minimal detectable concentration of bFGF in serum was less than pg/ml, and the interassay and intra-assay variances ... crossreactivity to VEGF121, but not to factors related to VEGF such as human placental growth factor and plateletderived growth factor Interassay and intra-assay variances were less than 10% The...
- 10
- 432
- 0
Báo cáo khoa học: "Prognosticators and Risk Grouping in Patients with Lung Metastasis from Nasopharyngeal Carcinoma: A more accurate and appropriate assessment of prognosis" doc
... head and neck, chest X-ray and an ultrasound scan of the abdomen A CT scan of the thorax or the abdomen and a bone scan were performed if the initial examination revealed abnormal findings that ... 45:2981-2985 41 Nibu K, Nakagawa K, Kamata S, Kawabata K, Nakamizo M, Nigauri T, Hoki K: Surgical treatment for pulmonary metastases of squamous cell carcinoma of the head and neck Am J Otolaryngol 1997, ... obtain a more accurate and appropriate assessment of the prognosis of a lung metastatic NPC patient and could facilitate the establishment of patient-tailored medical strategies and supports Acknowledgements...
- 10
- 621
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
... necrosis factor family (BAFF) -and a proliferation-inducing ligand (APRIL) are members of the tumor necrosis factor (TNF) family and are important regulators of B-cell maturation, survival, and function ... versus a plasmablastic signature Blood 2005, 106:1021-1030 Watanabe R, Fujimoto M, Yazawa N, Nakashima H, Asashima N, Kuwano Y, Tada Y, Maruyama N, Okochi H, Tamaki K: Increased serum levels of a ... trimers as a reference standard, but nevertheless, was also able to detect AB2 trimers During Page of 14 the assay, beads conjugated with an anti-APRIL mAb were incubated with the test sample and washed,...
- 14
- 460
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 2 potx
... containers Figure 3.4 Manual markup on a page layout 0002 0001 34 Chapter To use the < and > characters as part of a tag, these characters cannot be used in content, and therefore they are replaced ... languages Any language created via the rules of XML, like the Math Markup Language (MathML), is called an application of XML A markup language’s primary concern is how to add semantic information ... is “has Ancestor.” Here is how the rule applies to the “has Ancestor” property: If Joe hasAncestor Sam and Sam hasAncestor Jill, then Joe hasAncestor Jill Lastly, the Web ontology language being...
- 31
- 452
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 3 pdf
... DTD and XML Schema) XPath is a language to select a set of nodes within a document Load and save methods specify a standard way to load an XML document into a DOM and a way to save a DOM into an ... general rule applies that “more is better.” Meta data increases the fidelity and granularity of our data The way to think about the current state of meta data is that we attach words (or labels) to ... or customers (directly) to access information when they want and wherever they are (including wireless) Databases and data mining XML has had a greater effect on relational database management...
- 31
- 436
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 4 pdf
... the capability to search for available cars on a certain date, lists rental rates, and allows an application to make a reservation for a car Expense report creator This Web service automatically ... relates to SAML in the sense that SAML provides the mechanism of propagating authentication and authorization information between services and servers, and XACML is the authentication and authorization ... documents attach meta data to parts of a document, one use of RDF is to create meta data about the document as a standalone entity In other words, instead of marking up the internals of a document,...
- 31
- 471
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 5 ppsx
... methods) An object is one instance of a class OO languages also allow classes to inherit characteristics and behaviors from a parent class (also called a super class) The software industry has recently ... concepts, we layer the XML Syntax (elements, attributes, and angle brackets) and namespaces to avoid vocabulary conflicts On top of XML are the triple-based assertions of the RDF model and syntax we ... goals and practical uses of each XPath XPath is the XML Path Language, and it plays an important role in the XML family of standards It provides an expression language for specifically addressing...
- 31
- 367
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 6 ppsx
... associative relationships among terms are displayed clearly and identified by standardized relationship indicators The primary purposes of a thesaurus are to facilitate retrieval of documents and ... theory.” The following common languages and technologies are displayed in the diagram: ■■ Database models: the relational language (R), the Entity-Relational language and model (ER), and the Extended ... terms, that are synonymous at roughly the same level of abstraction (i.e., they are not at either the parent or child level, with respect to each other) are grouped together as a set The synset therefore...
- 31
- 355
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 7 ppt
... isa Management_Employee manages Class Organization isa isa isa manages part _of isa manages President Class Company manages isa isa Manager Class Department Director Class Division manages isa ... terms of the things that are important to the notion of automobile repair, and their properties and relationships Given a particular way of thinking about a part of the world (a subject area or ... tries to capture the meaning (what we will call semantics) of a particular subject area or area of knowledge that corresponds to what a human being knows about that domain An ontology also characterizes...
- 31
- 358
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 8 pdf
... describe and represent an area of knowledge and the meaning of that vocabulary—that is, it is syntactically a language of types and terms that has a corresponding formal semantics that is the intended ... transition tables are often used to express the semantics and pragmatics of the communication acts of the agents A communication act, for example, would be a request by one agent to another agent ... of knowledge is the intension and the second is the extension In the database world, a schema is the intensional database, whereas the tuples of the database constitute the extensional database...
- 31
- 358
- 0
The Semantic Web:A Guide to the Future of XML, Web Services, and Knowledge Management phần 9 pps
... teased apart the statement into three parts: a management employee part, a managing an organization part, and a manages part But in Table 8.9, we will just that Table 8.8 Predicate Logic Example ... code.23 Finally, at the top are reasoning and proof methods, and the so-called “web of trust” layer, which uses automated proof, as well as security and identity features that are still relatively ... hasFather, Father is the range of the property hasFather This simply means that any instance/individual in the domain must be a member of the Child class; any instance in the range must be a...
- 31
- 253
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose