a d conversion example a temperature sensitive switch
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... autoradiography The open arrowhead indicates a truncated product derived from vRNA B Radiolabeled products for m- c and vRNA were quantified by densitometry The ratios of cRNA:mRNA and vRNA:mRNA ... where a negative polarity CAT segment was introduced, the ratios of cRNA to mRNA and vRNA to mRNA changed by around fold across the temperature range When a cRNA-like CAT RNA was transfected the ... (3'-end) A Total RNA was harvested and analyzed by primer extension as described before to detect virus-derived CAT RNA species B Radiolabelled products for mand vRNA were quantified by densitometry...
- 16
- 313
- 0
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf
... designed and constructed as described has been used to measure and profile the beta radiation from an Sr-90 brachytherapy source and was found to be particularly easy to use and to provide stable and ... time, as any drift in the DC bias level arising from the buffer stage would be additive and indistinguishable from the wanted input signal A UDT PIN 5DPI precision photodiode was used as a sensor during ... generated noise and furnishes a compact and low cost method for the capture and integrated digital processing of measurement data in a range of situations including clinical diagnostic and treatment venues...
- 6
- 391
- 0
A very high speed bandpass continous time sigma delta modulator for RF receiver front end a d conversion
... basic concepts involved in analog-to-digital conversion and in a Sigma-Delta modulator has an ADC are looked upon The different types of Σ∆M are also discussed along with their respective advantages ... in a DT modulator, say a switched capacitor modulator, the op amp output voltage is sampled after a safe margin of settling which includes delays caused by switching of transistors in latches and ... channel filter passes the desired IF channel suppressing the adjacent channels by about 30-40dB After amplification the signal is quadrature mixed into In-phase and Quadrature-phase channels at...
- 112
- 359
- 0
A study on the ph temperature sensitive biodegradable hydrogels for controlled protein and drug delivery
... Nakamura, T Yamagata, K Takayama ,A M Lowman, J Control Release, 97, 115 (2004) [9] T Yamagata, M Morishita, N J Kavimandan, K Nakamura, Y Fukuoka, K Takayama, N A Peppas, J Control Release, 112, ... wt% After that, TEA and acryloyl chloride are added at 10 °C The acrylation reaction is carried out for 48 h under a dry nitrogen atmosphere A rotary evaporator at ambient temperature is used to ... matrix are easier, those are non-degradable polymer Biodegradable hydrogels have been interested as an attractive insulin formulation because they have many advantages such as biocompatibility and...
- 170
- 260
- 0
Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx
... should be a or 25-pin male connector labeled serial or COM1 It may or may not be identified Step Locate the RJ-45 to DB-9 adapter One side of the adapter connects to the PCs serial interface and ... rollover cable connector If the serial interface on the PC or dumb terminal is a DB-25, an RJ-45 to DB-25 adapter will be needed Both of these adapters typically come with a Cisco router or switch ... Finally, attach the adapter to a PC serial port, either DB-9 or DB-25, depending on the computer Step Start the PC HyperTerminal program a Turn on the computer b From the Windows taskbar, locate the...
- 6
- 476
- 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average ... Average amplicon size (bp) DENV-1 CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ... GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT 10451 10671 10438 10660 9057 9305 10482 10661 104 382 9903 10318 219 DENV-2 DENV-2 DENV-1 DENV-3...
- 12
- 795
- 0
Tài liệu COUNSELING and PSYCHOTHERAPY with ARABS and MUSLIMS A Culturally Sensitive Approach doc
... lan yosibuna illa ma katab Allah lana howa mawlana wa ala Allah falyatawakal el-mo amenin” (Al-tawbah #51) [Say: Nothing will befall us except what God has ordained He is our Guardian In God ... is documented in the verse, “Wala tahsabanna alatheena qotilou fi sabeel Allah amwatan bal ahya a and Rabbihem yorzaqoon” (Al -A mran #169) [Do not consider those who died for God dead but rather ... such as Al Tabari, Mohamad Abdu, Al-Afghani, and Al-Tahtawi, who, offered moderate, democratic, and egalitarian Islamic attitudes (see Hourani, 1983) This search for new meanings may have a therapeutic...
- 187
- 333
- 0
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc
... negative sentiment) given a small set of labeled data for the source domain, and unlabeled data for both source and target domains In particular, no labeled data is provided for the target domain ... unlabeled data enables us to accurately estimate the distribution of words in source and target domains Our method can learn from a large amount of unlabeled data to leverage a robust cross-domain ... contribution of unlabeled data Figure shows classification accuracy on the DVD target domain when we vary the proportion of source domain unlabeled data (target domain’s unlabeled data is fixed) Likewise,...
- 10
- 555
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... extracted plasmid DNA was used to transform JB69 by selecting on plates at 23 °C containing Amp and 5% sucrose to displace the resident Kan plasmid Candidate mutants were purified, plasmid DNA extracted, ... pTrc9 9A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT ... TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed in CVR69L and JB69 to generate CVR69LDrnc and JB69Drnc, respectively (Table 1) A pTrc99A...
- 12
- 439
- 0
Báo cáo khoa học: "A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors" pptx
... (Toutanova and Manning, 2000; Toutanova et al., 2003; Manning, 2011) In addition, various supervised methods such as HMMs and CRFs are widely applied to POS tagging Lafferty et al (2001) adopted ... Empirical Methods in Natural Language Processing and the Conference on Computational Natural Language Learning pp 296–305 Taku Kudo, Kaoru Yamamoto, and Yuji Matsumoto 2004 Applying Conditional Random ... Natural Language Processing pp 133–142 Fei Sha and Fernando Pereira 2003 Shallow Parsing with Conditional Random Fields In Proceedings of the Human Language Technology and North American Chapter...
- 10
- 406
- 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... precipitated, washed with 70% ethanol and analyzed on 6% denaturing polyacrylamide gels in ã Tris/borate/EDTA at room temperature Gels were dried and subjected to autoradiography Cell culture and transfection ... acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon ... (5Â-CGGGATCCCAATCTGTTGCTAA TTAGG-3Â) and the 3Â specic oligonucleotides (5Â-GA AGATCTACCACACCTCCTCATCTCC-3Â) for amplication of the region from )180 to )36 and (5Â-GAAGAT CTAACTAGATTTTACCATTGG-3Â) for amplication...
- 10
- 475
- 0
Báo cáo khoa học: "A Morphologically Sensitive Clustering Algorithm for Identifying Arabic Roots" docx
... Adamson's algorithm on Arabic data to assess its ability to cluster words sharing a root Each of the data sets was clustered manually to provide an ideal benchmark This task was executed by a ... semantically related pairs of words and document titles Information Storage and Retrieval, Vol 10, pp 253-260 Al-Fedaghi Sabah S and Fawaz Al-Anzi (1989) A new algorithm to generate Arabic root-pattern ... 92.91% The algorithm deals with weak letter mutation, and infix appearance and disappearance in words sharing a root (eg the root qwm and its derived words, especially the role of Hamza as an infix...
- 8
- 263
- 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area of the substrate peaks For the identification ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification...
- 11
- 424
- 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx
... 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ (-20 downstream oligo) 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ P (-20 downstream ... mungbean DNA polymerase appeared at 62 kDa (data not shown) SDS ⁄ PAGE analysis of the ssDNA agarose fractions revealed a single polypeptide band of 62 kDa (Fig 2A) , which was also estimated from ... of nuclear DNA Highly processive DNA polymerases such as DNA polymerase d and ⁄ or e and a (for repeated initiation) are involved in repeated rounds of DNA synthesis during endoreduplication However,...
- 19
- 350
- 0
Báo cáo khoa học: "A Context-sensitive, Multi-faceted model of Lexico-Conceptual Affect" pdf
... which a pair of stereotypical properties or behaviors X and Y are linked via coordination, as in “hot and humid” or “kicking and screaming” A bidirectional link between X and Y is added to the ... Language Resources and Evaluation, Lisbon, Portugal Hiroya Takamura, Takashi Inui, and Manabu Okumura 2005 Extracting semantic orientation of words using spin model Proceedings of the 43rd Annual ... in -R are correctly assigned a negativity score greater than 0.5 (neg(S) > pos(S)) by (6) We can also use +R and -R as a gold standard for evaluating the separation of typical(S) into distinct...
- 5
- 180
- 0
![[Khiem] improvement of matrix converter drive reliability by online fault detection and a fault tolerant switching strategy IEEE trans](https://media.store123doc.com/images/document/14/y/ib/small_ibr1399917315.jpg)
[Khiem] improvement of matrix converter drive reliability by online fault detection and a fault tolerant switching strategy IEEE trans
... proposed method has several key advantages First, no extra hardware devices are needed Second, the entire fault detection and postfault processing are executed by a digital signal processor (DSP) ... University, Auburn, AL Dr Hung has received several awards for his teaching and research activities, including a Best Paper Award from IEEE T RANSACTIONS ON I NDUSTRIAL E LECTRONICS He served as a Treasurer ... performance with the proposed switching strategy has been also presented In summary, a fully software-based fault-tolerant method requiring no redundant hardware devices has been proposed and demonstrated...
- 13
- 386
- 0
A digitally controlled switch mode power supply based on matrix converter
... University Faculty Fellow Award for demonstrated achievement of excellence in research, scholarship and leadership in the field, and he directed a team of students to design and build a low cost ... electronic hardware for flywheel, ultracapacitor type energy storage/discharge devices for ride-through and utility interface issues Dr Enjeti received the IEEE-IAS Second and Third Best Paper Award in ... University, Daejeon, Korea His research interests are high power converter, ac/dc, dc/ac and ac/ac converter topologies, power quality and utility interface issues for distributed energy systems, and advanced...
- 7
- 395
- 1
Báo cáo toán học: " Pretargeted immuno-PET of CEA-expressing intraperitoneal human colonic tumour xenografts: a new sensitive detection method" doc
... tumor and a small radiolabeled molecule is injected When the bsmAb has cleared from the blood and has accumulated in the tumor, a radiolabeled and hapten-conjugated peptide that clears rapidly ... Statistical analyses Statistical analysis was performed using the SPSS software (Chicago, IL, USA) and GraphPad Prism version 5.00 for Windows (GraphPad Software, San Diego, CA, USA) Means and ... conceived the study, carried out the imaging studies and the analysis of the studies, and drafted the manuscript WTAG conceived the study and helped draft the manuscript RMS participated in the design...
- 18
- 258
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008