... in activated cells of S phase was also included as test of more functional relevance An important key regulator ofthe apoptotic pathway such as caspase-3 was also evaluated immunohistologically ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value ofthe untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...
... T, Sawodny O, Ederer M & Heyer AG (2010) Mathematical modelling ofthe central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... significantly different cold-acclimation capacities, we prove that mathematical modelling of metabolism and validation by experimental data offers an attractive possibility forthe study of complex...
... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan...
... 60°C 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG AGCA-3' [GenBank: NM_174112] ... processed for mRNA analysisofthe SFB layer and cartilage For each experimental parameter, patient SFB were analysed separately for each donor After 14 days of in vitro co-culture, multiple layers of ... Human/bovine Aldolase A 5'TCATCCTCTTCCATGAG ACACTCTA-3' 5'ATTCTGCTGGCAGAT ACTGGCATAA-3' [GenBank: NM_000034] 58°C 88°C Human MMP-1 5'GACCTGGAGGAAATCT TGC-3' 5'GTTAGCTTACTGTCACA CGC-3' [GenBank: NM_002421]...
... above the significance cutoff, 'array density' ofthe peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate ofthe number of actual raw data measurements that underlie each peak Properties of ChIP-chip ... Gaussian distribution with a mean of zero The variance ofthe observations is estimated by the average sum ofthe squared negative log ratios Underthe null hypothesis, the distribution of the...
... vigorously fora few seconds The minute extraction ofthe entire batch can be performed in parallel after the salts have been added to all the samples Michelangelo Anastassiades, CVUA Stuttgart QuEChERS ... Co-extracted fat and waxes may negatively affect the ruggedness ofthe GC analysisThe co-extracted fats or waxes can be separated from the extracts to a large extent by putting them in the freezer ... degraded to carbofuran within the samples as well as in the extracts at pH Thus, merely if carbofuran is present in the acidified extract an additional run ofthe alkaline aliquot is needed Normally...
... A numeerical modell forthe lineear analysis and nonlineear analysisofsteel conncrete CB with w partial sheear interactio on capable of o accountinng forthe shhear deformaability of booth componeents ... nce ofthe prroposed model against the data of Gaattesco (1999 9) and experrimental dataa The load versus v mid-sspan deflectiion is plottedd in Fig 14 annd the valuess of slip at the t steel conncrete ... daata In Fig 17, it can be noted n that thee curve of thhe analyticaal results liess almost alw ways among the experimenntal results ofthe two hallves ofthe bbeam Fig.17 Deflected shappe at...
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... result in a gain for others The optimal management of shared stocks is an area that requires collaborative effort among the littoral nations ofthe Bay of Bengal and the Andaman Sea Demersal fish...
... wave breaking on a natural beach To verify the accuracy ofthe numerical model on the simulation ofthe wave transformation on a natural beach, existing experimental data on the wave dynamics in ... suitable fora practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated that in the surf zone, the time scale ... wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ...
... select Theta-Alpha band activity on central and temporal channels (TL, TR, CL and CR) for further analysisof our results from univariate analysis In Table we analyze the spectral biomarkers ofthe ... the Beta band over the frontal lobe Forthe Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier, the ... from the WT approach (FL, FR, CR, OL from the theta band and FL, PL, OL from the alpha band) and features from the MS-COH approach (FTR, OPL from the Theta band Table 1: Average WT Biomarker Values...
... and Gianola [8] extended the standard threshold model to amodel allowing for heterogeneous variances ofthe Gaussian latent variables using a log-linear modelforthe residual variances In the ... to be a natural alternative to the MAP approach proposed by Foulley and Gianola !8! The main advantage ofthe MAP approach lies in both its conceptual and computational simplicity Part of this ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches to theanalysisof heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13...
... depth of barium titanate particles in the temporary cavity The radiological examination ofthe infiltration depth of barium titanate particles within the ruptures ofa temporary cavity in the gelatin ... size ofthe temporary cavity and the infiltration depth ofthe barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case ofthe full metal jacket ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysisof penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head...
... on the array, the geometric mean ofthe measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the ... Immunosorbent Assay (ELISA) and Northern blot analysis that not allow for simultaneous multi-target analysis To determine whether a multi-virus microarray had potential in specific applications, for instance ... on the average ofthe intensity across the array set was then obtained A ratio greater than indicates that there was hybridization to a specific gene 2-fold above the background intensity across...
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
... performance database was designed to store the majority ofthe data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... Transportation Research Board (TRB) ofthe National Research Council, underthe sponsorship ofthe Federal Highway Administration (FHWA) and with the cooperation ofthe American Association of State ... SEASONAL MONITORING PROGRAM 4.1 Data Acquisition The first and foremost important task for this research was the collection ofthe required data that could be used forthe data analysisThe Transportation...
... release in the rat striatum (A) Nicotine acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one ofthe first antagonists ... tool forthe specific localization and further characterization of these important subtypes Characterization of nAChR subtypes in the avian ciliary ganglion Another example where a- conotoxins have ... ease of synthesis, makes AuIB is present in intracardiac ganglia, or that the a3 b4* them particularly useful templates forthe design of receptors in intracardiac ganglia form a substantially optimized...
... the plasma A default flow of oxygen is added to the carrier gas flow (e.g Oxygen at 5% ofthe total argon carrier flow) and the organic solvent is aspirated at an appropriate flow rate The oxygen ... solution into the spray chamber by self-aspiration The spray chamber and plasma torch are made of highpurity quartz and any seals in the sample introduction and drain systems are replaced with solvent ... temperature of -5oC, and a narrow ID torch to maintain plasma stability Performance The ICP-MS sample introduction setup fortheanalysisof volatile organic solvents such as isopropyl alcohol (IPA) involves...
... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... discounted salvage value ofthe vehicle, and ACMi is the smoothed average cumulative mileage for vehicles of age group i VaRooM also compares the average cost ofa candidate vehicle for replacement...
... into a formal, and in particular, a computational analysisof d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties which offers the ... initial creation ofthe situation-type (the first clause), the interpretation of but and the modification ofthe initial situation-type to accommodate the information in the second clause SPEECH ACTS ... NEGOTIATE Clearly given the manifest success o f urban Japanese u} obtain lucrative foreign contracts, the absence of such a spcech act-type among rural Japanese cannot be attributed to facts of the...