a critical survey in the context of experimental data

Environmental performance and sustainable architecture  a critical review in the context of singapore public housing  2

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 2

Ngày tải lên : 16/09/2015, 08:29
... matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 An A1 a1 /a1 a1 /a2 a1 /an A2 a2 /a1 a2 /a2 a2 /an An an /a1 an /a2 an/an 149 where ai/aj = aj/ai for all ... block The calculation is based on estimates of average annual local rainfall, absorption capacity of site through permeable paving and landscaping (See 6.3.3.) All waste water in the housing block ... Quality of parking area development Parking areas are in multi-storey carpark surrounded with some landscaping, and dedicated walkways lead from parking areas to a building entrance S.6 Impact...
  • 75
  • 365
  • 0
Environmental performance and sustainable architecture  a critical review in the context of singapore public housing  3

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 3

Ngày tải lên : 16/09/2015, 08:29
... distance of available point that horizontal and downward views are available of the interior of bedroom and living areas of certain percentage of dwelling units of the building Interpreting from ... percentage of greenery area in the site In daylight factor, other constituting components in the measurement include the total area and reflectance of interior surfaces, the total area and average ... performance, the building footprint area (Af) and the percentage of hard-paved area of the site (P) should be kept as low as possible, and the total net usable area of the building (Anet) should be as large...
  • 131
  • 400
  • 0
Environmental performance and sustainable architecture  a critical review in the context of singapore public housing  4

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 4

Ngày tải lên : 16/09/2015, 08:29
... criticism and debate' (as in the words of Guy and Farmer, 2001) 329 14.3 Towards sustainable public housing in Singapore In substantiating the main discourse of environmental performance and sustainable ... potential sustainable performance of the project, based on the information available at the end of the Design phase Because the information available during the Pre-Design and Design phases are likely ... few indicators are available in this phase Assessment during the Operations phase is intended to provide an objective and factual indication of the Actual performance of the project, and the...
  • 59
  • 395
  • 0
Environmental performance and sustainable architecture  a critical review in the context of singapore public housing 1

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 1

Ngày tải lên : 16/09/2015, 08:29
... Conference in Canada The objective of GBC is not a commercial tool, but rather a research and testing tool acting as a generic framework for global practice and national adaptation In the words of Raymond ... positioning the critical review of the practice of BEAMs and the established Integrated Framework for Sustainable Housing Design and Discourse into the larger context of contemporary theories and practices ... customizing and inputting local context, benchmarks, weightings, and datasets of building to be assessed, together with assessing data and reporting the results of environmental performances The organising...
  • 113
  • 271
  • 0
a literature survey of active machine learning in the context of natural language processing

a literature survey of active machine learning in the context of natural language processing

Ngày tải lên : 02/06/2014, 09:22
... achieved by active learning algorithm A and t amount of training data, and Acct (L) is the average accuracy achieved using random sampling and learning algorithm L and t amount of training data The deficiency ... separate views of learning the same target concept As in active learning, Co-training starts off with a small set of labeled data, and a large set of unlabeled data The classifiers are first trained ... labeled data, as well as a large set of unlabeled data Co-testing proceeds by first learning a hypothesis using each view of the data, then asking a human annotator to label the unlabeled instances...
  • 59
  • 692
  • 0
Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study

Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study

Ngày tải lên : 07/11/2012, 14:54
... University In the past, most of these teachers mainly used the GrammarTranslation Method - a way of teaching and learning a foreign language on the basis of detailed analysis of grammar rules and application ... important in working in pair or group If they are afraid of making mistakes, afraid of losing face, they can not make use of the chances to express their ideas and show their language use Their teachers ... one of the most important and useful activities in language classes Some of them think it as a vital activity in language teaching After answering all questions about the time, the benefits, the...
  • 62
  • 1.3K
  • 6
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC

A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC

Ngày tải lên : 07/09/2013, 13:06
... is the learners and the teachers who play the primary role in managing a disciplined atmosphere in the classroom In the light of Communicative Language Teaching, where the roles of the learners ... and the same main point: the understanding of this relationship is exclusively vital for discipline to be satisfactorily maintained I.4 Factors affecting discipline and motivation in a language ... to maintain discipline and motivate language acquisition in a language classroom It also goes further to point out specific steps towards helping teachers in a certain classroom to make the most...
  • 41
  • 886
  • 12
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Ngày tải lên : 15/01/2014, 15:59
... employee quality training and pervasiveness of the quality management system An important advantage of CIT and SIT is the usability of the data gathered with them for improving service levels (Edvardsson ... & Kawani, 1982) Therefore, it can be argued that the aggregate satisfaction of the buying organization is a rather complex function of satisfactions of individual, from an importance viewpoint, ... organization as a whole or the satisfaction of certain individuals within that organization These are clearly two different issues, since in the context of a project delivery, there are several individuals...
  • 37
  • 1.1K
  • 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Ngày tải lên : 07/03/2014, 21:20
... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... other distantly related protein families involved in DNA binding and chromatin stability Moreover, additional experimental data place the DIDO protein in the context of cell division Our analyses ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain...
  • 7
  • 658
  • 0
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

Ngày tải lên : 15/03/2014, 16:20
... sustainability Pearce suggests focusing on savings rates and argues that sustainability in the weak sense means that the value of savings must at least equal the depreciation of manufactured capital ... normalized so that an index of one indicates that the increase in man-made capital is offset exactly by the depreciation of the nation's natural assets An index much less than one indicates that resource ... are aggregated first under each attribute and then into a single Approximated Sustainability Index But the indicators of each attribute appear to be assigned somewhat arbitrarily and the attributes...
  • 58
  • 698
  • 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 18/06/2014, 22:20
... Interpretation Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories ... did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical analysis and was involved in the interpretation ... pre-testing experiments in his lab CMB was the proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation...
  • 13
  • 752
  • 0
o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 20/06/2014, 04:20
... Interpretation Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories ... did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical analysis and was involved in the interpretation ... pre-testing experiments in his lab CMB was the proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation...
  • 13
  • 579
  • 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

Ngày tải lên : 12/08/2014, 23:21
... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the ... one of the greatest advances in critical care medicine during the past decade Similarly, recent technology has also enhanced the quality of basic CPR For the past four decades, basic CPR has been ... magnitude of the public health impact of AEDs is potentially dramatic, in terms of both life-saving and ICU resources In summary, the use of AEDs by the average person may be considered one of...
  • 3
  • 280
  • 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Ngày tải lên : 13/08/2014, 01:20
... CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT ... CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The...
  • 12
  • 337
  • 0
Báo cáo y học: " Elevation of cardiac troponin I during non-exertional heat-related illnesses in the context of a heatwave" doc

Báo cáo y học: " Elevation of cardiac troponin I during non-exertional heat-related illnesses in the context of a heatwave" doc

Ngày tải lên : 13/08/2014, 20:22
... biological data YLM participated in statistical analysis BR participated in the conception and design of the study, statistical analysis and interpretation of data, and in drafting the manuscript Acknowledgements ... was considered as indicating myocardial damage A value >1.5 ng.L-1 was considered as indicating severe myocardial damage, as previously reported [18] Statistical analysis Data are expressed as ... pointed out that a high heart rate indicates a considerable heart strain in the clinical conditions of heatstroke and that an elevated serum creatinine level might reflect global dehydration The...
  • 9
  • 298
  • 0
A study on using authentic materials in teaching English in the context of Bac Giang High school for gifted students = Nghiên cứu việc sử dụng tài liệu xác thực

A study on using authentic materials in teaching English in the context of Bac Giang High school for gifted students = Nghiên cứu việc sử dụng tài liệu xác thực

Ngày tải lên : 28/03/2015, 08:53
... exploring authentic materials as well as in mastering the language Fourthly, adapting authentic materials is an important task in the process of language teaching Authentic materials should be suitable ... from using authentic materials in language teaching and learning The third problem is that obtaining and adapting authentic materials can be timeconsuming Teachers may need to spend hours and hours ... teaching English In terms of the frequency of using authentic materials, out of teachers shared the opinion that they often used authentic materials in the classroom They reasoned that using authentic...
  • 57
  • 2.3K
  • 7
Globalization and liberalization of higher education services under world trade law a study on WTO GATS and free trade agreements in the context of international trade in higher education services

Globalization and liberalization of higher education services under world trade law a study on WTO GATS and free trade agreements in the context of international trade in higher education services

Ngày tải lên : 07/10/2015, 10:02
... Chuan Chin Yee, Ms Normah Bte Mahamood, Zanariah Zainal Abidin M and Mr Mohamad Razali Bin Sak Yok for their efficient administrative assistance Thanks to CJ Koh Law Library staff led by managers ... Mee Lan and Mrs Thavamani Ratnasamy for always extending their helpful assistance I also thank all the staff at Central Library and Office of Student Affairs I thank following persons for sharing ... phrase was given in the GATS context and the panel had held that the ordinary meaning of the term “affecting,” in Art I: of GATS, did not convey any notion of limiting the scope of GATS to certain...
  • 302
  • 1.2K
  • 0
Sustainable livelihoods in coastal red river delta in the context of climate change a case study in nam dinh province

Sustainable livelihoods in coastal red river delta in the context of climate change a case study in nam dinh province

Ngày tải lên : 09/05/2016, 16:55
... through a case study in Nam Dinh Using the analytical framework of adaptive capacity which is divided into two levels: passive adaptation and active adaptation and data from the household survey in ... institutions and policies on climate change adaptation: Mainstreaming climate change adaptation into development planing • Mainstreaming climate change into national or regional policies • Mainstreaming ... Improving natural capital • Improving physical capital • Improving financial capital • Improving human capital • Improving social capital 1.3.4.2 Creating enabling environment in terms of institutions...
  • 12
  • 401
  • 0
The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

Ngày tải lên : 05/09/2013, 14:19
... countries in drafting and negotiating bilateral tax treaties, with a view to maintaining the desired balance What isobtaining more tax revenue from foreign investment and special about the UN Model ... exchange of information • New Article 27 on “Assistance in the Collection of Taxes” • All changes in the above Articles accompanied by corresponding changes in the relevant Commentaries Other ... 13, paragraph 5, to address possible abuses • Optional version of Article 25, providing for mandatory binding arbitration • New version of Article 26, confirming and clarifying the importance of...
  • 14
  • 489
  • 0

Xem thêm