a couple dozen double barreled phrases and an equal number of sawed off words and abbreviations
Health and Quality of Life Outcomes BioMed Central Review Open Access An increasing number of pdf
... asked) and in reminding qualitative researchers of the need for a systematic approach (by providing a memorandum of the various stages involved in research design and data analysis) Checklists can ... criteria: ((#1 OR #2) AND #3) AND ((quality AND life) OR (patient AND reported AND outcome) OR (pro) OR (health AND outcome)) Field: Title/Abstract, The methodological characteristics of the papers ... of qualitative paradigm The achievement of high methodological standards and the attention to an appropriate reporting of fundamental methodological aspects (such as the methodological approach...
- 9
- 352
- 0
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt
... REPDEL-3 ALA-4 REP 4A REP4B ACMHIS AcmArevnru AcmAFsca AcmArep2F AcmArep3F AcmAreveco CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA ... AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG ... C The N-acetylglucosaminidase AcmA Fig (A) Expression of AcmA derivatives A1 , A2 , A3 and A4 in the L lactis NZ9000 mutants acmAD1 and acmAD1 DhtrA, visualized by zymographic analysis of culture...
- 15
- 460
- 0
Báo cáo toán hoc:" Almost all trees have an even number of independent sets " ppt
... convergence of H1 , H2 , H3 is larger than ρ At the dominating singularity, the Jacobian determinant of this system of functional equations has to vanish (otherwise, T01 , T10 , T11 would have analytic ... Fibonacci Quart., 21(3):219–229, 1983 [12] P Kirschenhofer, H Prodinger, and R F Tichy Fibonacci numbers of graphs III Planted plane trees In Fibonacci numbers and their applications (Patras, ... a branch cut along the negative real axis that ends at − e ˜ H1 and H2 have larger radius of convergence than T and U respectively (which follows from their definitions) Therefore, the dominating...
- 10
- 237
- 0
Báo cáo y học: "An unusual case of gout in the wrist: the importance of monitoring medication dosage and interaction. A case report"
... important and patients who have had a previous attack of gout should be made aware of common signs and symptoms, treatment protocols during an acute attack, and that gout may occur in any joint of ... Clinicians should be aware of the various comorbidities associated with gout which include hypertension, cardiovascular disease, and diabetes Awareness of prescribed medications and any dosage changes ... remain the imaging examination of choice for gouty arthritis although advanced imaging techniques may be used The appearance of gout in MR imaging is variable Joint effusion and para-articular...
- 5
- 800
- 0
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school
... Brown and Yule’s (1983: 127), speaking skill consists of short, fragmentary utterance, in a range of pronunciation There is often a great deal of repetition and overlap between one speaker and another ... is of an acceptable level: this means that the language used by teachers and learners to express their ideas and thoughts is understandable to others Thus, from the characteristics of spoken language ... one of the most popular languages nowadays and the aim of learning a language is to communicate 30 with people Meanwhile, one of the interviewees reluctantly answers that it is rather important...
- 44
- 841
- 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... Tariq, A. , Keshav Kant and Panigrahi, P K., “Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat and Mass transfer ... rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square channel ... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004;...
- 12
- 831
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... to range between 0.75 and 2.00 kg/plant and 4.00 and 6.00 MT per hectare per year depending on agro-climatic zone and agriculture practices One hectare of plantation on average soil will give 1.6...
- 12
- 568
- 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis ... solutions and precision measurements Nucl Instr Meth Phys Res A2 98: 13–21 Bhawalkar D D, Bhujle A G, Fatnani P, Hannurkar P R, Joshi S C, Karmarkar M G, Kotaiah S, Mhaskar S P, Pande S A, Prabhu S...
- 8
- 650
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection ... 2005; Soricut and Brill, 2006), as have the human-powered question sites such as Answers.com, Yahoo Answers and Google Answers, where individuals can post questions and receive answers from peers ... and Application of Large-scale Knowledge Resources (COE-LKR)” References Yllias Chali and Maheedhar Kolla 2004 Summarization Techniques at DUC 2004 In DUC2004 Hoa Trang Dang, Diane Kelly, and...
- 9
- 610
- 1
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... backbone w angle restraints were obtained from analysis of dNa/daN ratios [38] The w angle restraint was set to )30° ± 110° for dNa/ daN ratios less than 1, and to 120° ± 100° for dNa/daN ratios ... Engineering Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry References ... Isolation, purification and partial characterization of plantaricin 423, a bacteriocin produced by Lactobacillus plantarum J Appl Microbiol 84, 1131–1137 22 Jack, R.W., Wan, J., Gordon, J., Harmark,...
- 9
- 519
- 0
AN IMPROVED METHOD OF CONSTRUCTING A DATABASE OF MONTHLY CLIMATE OBSERVATIONS AND ASSOCIATED HIGH-RESOLUTION GRIDS docx
... Europe and South America is particularly acute The temporal and spatial density of observations may be due to the limitations of this particular database, of data exchange and storage, or of the ... the candidate station Each parallel was adjusted to match the statistical characteristics of the candidate to avoid any implicit weighting, and was then explicitly weighted by the square of its ... metadata that can be retained, and fixes the units and precision of the data The latitude and longitude attached to a station record were critical when homogenizing it, so each stated location was...
- 20
- 443
- 0
báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx
... the data and wrote the manuscript; XL performed cell culture, western blot analysis, ELISA assay and NO measurements; RL and LS helped in performing NO measurements All authors read and approved ... Iannitelli DAE, Cataldi A, Zara S, Nasuti C, Di Stefano A: Ibuprofen and Glutathione Conjugate as a Potential Therapeutic Agent for Treating Alzheimer’s Disease Arch Pharm (Weinheim) 2010 Ray B, Lahiri ... production of pro-inflammatory cytokines (IL-6, IL-1b, and TNF -a) and the expression of inflammation-related proteins (iNOS, COX-1, and COX-2) in LPS-activated microglia and astrocytes, and we explored...
- 7
- 409
- 0
Báo cáo hóa học: " Evidence that the Nijmegen breakage syndrome protein, an early sensor of double-strand DNA breaks (DSB), is involved in HIV-1 post-integration repair by recruiting the ataxia telangiectasia-mutated kinase in a " pptx
... HIV-1-based vector (lacZ reporter) at an m.o.i of 0.1 and harvested at the indicated time points (Figure 1A) ChIP analysis was used to identify accumulation of NBS1, ATM, and ATR at sites of proviral ... integration J Virol 2005, 79:2973-2978 Dehart JL, Andersen JL, Zimmerman ES, Ardon O, An DS, Blackett J, Kim B, Planelles V: The ataxia telangiectasia-mutated and Rad3-related protein is dispensable ... with the HIV-1-based vector at an m.o.i of 0.1 and chromatin immunoprecipitation was performed with anti-NBS1, anti-ATM and anti-ATR antibodies as described in the Experimental Procedures m –...
- 12
- 398
- 0
báo cáo hóa học:" False aneurysm of the interosseous artery and anterior interosseous syndrome - an unusual complication of penetrating injury of the forearm: a case report" potx
... M: Relief of subclavian venous and brachial plexus compression syndrome caused by traumatic subclavian artery aneurysm by means of transluminal stent-grafting J Trauma 1998, 45:972-4 Sauerbier ... the arm became newly swollen and painful A computer-tomographic-angiography (CTA) (fig 3) confirmed a false aneurysm of the IA An endovascular embolisation was planned, but suddenly excruciating ... secondary formation of a false aneurysm can explain both the hematoma and the anterior interosseous syndrome The glass fragment in the first motor bifurcation cannot be the sole explanation of the...
- 4
- 333
- 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C The working standard solutions were prepared by further diluting the stock standard ... quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and the LOQ were calculated on the basis of signal-to-noise ... conditions of wastewater are important factors for the occurrence and the behavior of dissolved and particle-bound organic pollutants in raw and treated wastewater (Figure 1) Precipitation runoff from...
- 13
- 589
- 0
Báo cáo hóa học: " A best-possible double inequality between Seiffert and harmonic means" potx
... mean bound for the Seiffert mean P (a, b) Very recently, Wang and Chu [8] found the greatest value a and the least value b such that the double inequality Aa (a, b)H1 -a( a, b) < P (a, b) < Ab (a, ... the double inequality aA (a, b) + (1 - a) H (a, b) < P (a, b) < bA (a, b) + (1 - b)H (a, b) holds for all a, b >0 with a ≠ b if and only if a ≤ 2/π and b ≥ 5/6; Liu and Meng [5] proved that the inequalities ... Chu et al Journal of Inequalities and Applications 2011, 2011:94 http://www.journalofinequalitiesandapplications.com/content/2011/1/94 Page of Mlog 2/ log π (a, b) and Mlog 2/ log π (a, b) is...
- 7
- 239
- 0
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... conceived and organized this study, and managed the survey of the vascular plants, the butterflies and of habitat structures DM and ST carried out all data analyses LS organized the survey of the grasshoppers ... types, climatic conditions and management regimes of a country; (2) baseline data necessary for detecting changes in the abundance and diversity of plants and animals as well as in habitat structures ... to a habitat-specific approach, the constant sampling size standardises sampling intensity and, hence, avoids sampling bias Species numbers of vascular plants, species numbers and abundance of...
- 12
- 497
- 0
Giáo án Anh văn lớp 9 - Unit 1: A VISIT FROM A PEN PAL - Getting started-Listen and read pptx
... While reading : Open prediction : Ask Ss to guess where Maryam went and what she did during the visit Ask Ss to lislen to the tape and read folow , then check check their prediction and add some ... to Dong Ba market We can shopping or I'll just introduce them a Vietnamese market S2: Good ideas! I believe they will be interested in it Language notes : I wish you had a longer vacation V.Homework:Ask ... vacation V.Homework:Ask students to write a short paragraph about what they have just discussed with their partner -Write a passage telling what you should take your pen pal to when s/he comes...
- 3
- 6,473
- 5
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008