a concept in human nutrition
Rice in human nutrition
... in China, 73 in Taiwan (province of China), 198 in the Republic of Korea and 158 in Japan In Asia, animals (buffalo and water buffalo, carabao) are still used for ploughing and harrowing Land ... Madagascar, Rwanda, Uganda, Zaire f Benin, Côte d'lvoire, Ghana, Guinea, Liberia, Sierra Leone, Togo g Burkina Faso, Chad, the Gambia, Guinea-Bissau, Mali, Mauritania, the Niger, Nigeria, Senegal ... domestication occurred independently in China, India and Indonesia, thereby giving rise to three races of rice: sinica (also known as japonica), indica and javanica (also known as bulu in Indonesia)...
- 166
- 905
- 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... the cDNA The purified cDNA was used as substrate in PCR with the following Ras-GRF1 gene-specific primers: ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ... ON359, 5¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢ Phospho-ERK1 ⁄ and phospho-Ras-GRF1 assay Direct measurements of [Ca2+]i in single cells The ... with MAP kinase activation Nature 383, 547–550 Toki S, Kawasaki H, Tashiro N, Housman DE & Graybiel AM (2001) Guanine nucleotide exchange factors CalDAG-GEFI and CalDAG-GEFII are colocalized in...
- 13
- 730
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... (primer A and C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers A and C) a faint 540 bp band (indicative ... cell association and degradation of 125I-labeled Table Specific binding of 125I-labeled HDL to choriocarcinoma cell lines at °C Binding constants were calculated by non linear regression analysis ... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase...
- 12
- 470
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 173...
- 13
- 563
- 0
Báo cáo khoa học: A ‘pure’ chemoattractant formylpeptide analogue triggers a specific signalling pathway in human neutrophil chemotaxis potx
... domain containing binding sites for Ca2+, phosphatidylserine and diacylglycerol, a small central hinge region and a COOHterminal catalytic domain [9–11] Upon activation, the kinase translocates from ... phospholipases C, D and A2 -mediated signalling in neutrophils Biochim Biophys Acta 1113, 135–160 Cui DY, Inanami O, Yamamori T, Niwa K, Nagahata H & Kuwabara M (2000) FMLP-induced formation of F-actin ... mitogen-activated protein kinase as a converging target for different growth factor signalling pathways: use of pertussis toxin as a discrimination factor Cell Regul 26, 75–84 Kazlauskas A & Cooper...
- 9
- 206
- 0
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... in a Divine Architect of the human form, the author can not refrain from occasionally pointing out His inimitable workmanship, and impressing the lesson of a Great Final Cause The author has ... violated law has been already incurred, and health irrevocably lost NATURE'S LAWS INVIOLABLE. In infancy, we learn how terribly Nature punishes a violation of certain laws, and how promptly she applies ... proportion varies with the age In youth it is nearly half and half, while in old age the mineral is greatly in excess By soaking a bone in weak muriatic acid, and thus dissolving the mineral matter,...
- 532
- 562
- 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... and bacterial, protease contamination Protein concentration was determined with a Bio-Rad protein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease ... staining as described in Materials and methods Marker proteins and their corresponding molecular masss are indicated in lane Lane 2, material from the acid extracts of granules; lane 3, material ... database and search engine Mass determination of proteins was done with the same instrument operated in linear mode and externally calibrated with a mixture of proteins Protein determination and...
- 12
- 486
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ⁄ ETTh, the 5¢ interface is ... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG ... replication has been demonstrated for a large variety of human cell lines; primate and canine cell lines may also be used [5] It has been extensively documented that the plasmids are maintained...
- 8
- 331
- 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt
... small intestine and brain, and at low levels in heart, placenta, liver, colon, and leukocytes [9,10] RGS5 acts as a potent GTPase activating protein for Gaq and Gai, but not Gas, and it attenuates ... plasmid: 5¢-GTTGGTGACCTTGTCATTCCG-3¢ (forward); 5¢-CT TGATTAACTCCTGATAAAACTCAGAGC-3¢ (reverse, NON-STOP CODON) Primers used for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ ... splicing occurred at both 5¢ and 3¢ regions generating four alternative isoforms encoding four distinct N-terminal domains and three distinct C-terminal domains [23] These intramolecular arrangements...
- 9
- 312
- 0
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control Melting-curve ... urokinase-type plasminogen activator is correlated with the malignant and invasive potential in meningiomas Cancer 89, 2292–2300 Jayaraman G, Srinivas R, Duggan C, Ferreira E, Swaminathan S, Somasundaram K, ... of acetyl-lleucyl-l-argininal, inhibitor of dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–681 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and...
- 15
- 325
- 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot
... were as follows: PAR-1, forward 5¢-CCTGCTTCAGTCTGTGC-3¢, reverse 5¢-CCAGGTGCAGCATGTACA-3¢; COL 1A1 , forward 5¢-CAAGACGAAGACATCCCACCA-3¢, reverse 5¢-CAGATCACGTCATCGCACAACA-3¢; AP-2, forward 5¢-ATGCCGTCTCCGCCATCCCTAT-3¢, ... Jolla, CA, USA) Butaprost was from Cayman Chemical (Ann Arbor, MI, USA) Antibodies against PAR-1 (WEDE15) were from Immunotech, antibodies against AP-2 were from Abcam (Biozol, Eching, Germany), ... PAR-1 gene [19,29] Interestingly, in the human alveolar epithelial A5 49 cell line, Sp1 inhibition, as in human lung fibroblasts, did not in uence the PAR-1 basal transcription, whereas in the human...
- 11
- 338
- 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
... By using NSC23766, our group recently unraveled a Ca2+ -dependent pathway regulating secretion in thrombin-stimulated human platelets linking Rac1 activation to actin dynamics: Calcineurin®Rac1 ... Such a broad inhibitory profile of a Rac1 inhibitor suggests that pharmacological targeting of Rac1 is an interesting approach for developing future antiplatelet drugs Methods Materials Acetylsalicylic ... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance...
- 10
- 441
- 0
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... Neale JH: Local administration of Nacetylaspartylglutamate (NAAG) peptidase inhibitors is analgesic in peripheral pain in rats Eur J Neurosci 2007, 25:147-158 22 Cangro CB, Namboodiri MA, Sklar...
- 8
- 406
- 0
Báo cáo sinh học: "Pro-apoptotic activity of a-bisabolol in preclinical models of primary human acute leukemia cells" pptx
... cytotoxicity of a- bisabolol in Ph + cells as compared to imatinib mesylate (A) Scaled a- bisabolol alone (solid line) or in combination with μM imatinib mesylate (dashed line) in representative cases out ... Dickinson) A sequential Boolean gating strategy was used to accurately enumerate different populations [15] Cytotoxicity data hierarchical clustering analysis To generate a classification based ... KDa 85 KDa PARP cleavage DNA ladder Figure a- bisabolol-induced mitochondrial damage in primary leukemic blasts Cells were stained with JC-1 In non-damaged cells, JC-1 forms red-emitting aggregates...
- 13
- 398
- 0
Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc
... for analysis Total RNA (1.5 μg) was amplified with an Amino Allyl MessageAmp aRNA kit (Ambion); 54 to 88 μg of amplified RNA (aRNA) was obtained The mean RNA size was 1,500 nucleotides, as observed ... Since DNA fragmentation represents a late apoptotic event, we analyzed the activation of effector caspases as a previous stage in the induction of apoptosis Apoptotic caspases are activated by a proteolytic ... carried out the microarrays studies JMG participated in the analysis of microarray data ME conceived the study, and participated in its design, coordination and writing All authors read and approved...
- 20
- 621
- 0
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... Neale JH: Local administration of Nacetylaspartylglutamate (NAAG) peptidase inhibitors is analgesic in peripheral pain in rats Eur J Neurosci 2007, 25:147-158 22 Cangro CB, Namboodiri MA, Sklar...
- 8
- 304
- 0
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx
... does in building spaces only Today’s A/ C systems: • Maintain a healthy building environment o In commercial and new residential, A/ C provides ventilation air to maintain indoor air quality o A/ C ... will create some market risk Designing and installing a new DEVap system requires retraining DEVap has unknown longevity and reliability compared to standard A/ C The availability of natural gas or ... remaining refrigerants used today (R41 0A and R-13 4A) are strong contributors to global warming Their global warming potentials are 2000 and 1300, respectively (ASHRAE 2006) Finding data on air...
- 61
- 423
- 0
Báo cáo y học: "A psychophysiological investigation of laterality in human emotion elicited by pleasant and unpleasant film clips" pptx
... separately for each ear), the ear side variable was dropped from further analyses and the data for each ear separately were subjected to a two-way MANOVA (sex (men and women) × valence (pleasant, ... three-way MANOVA (sex (men and women) × ear side (left and right) × valence (pleasant, neutral, and unpleasant)), with ear and valence as within-subjects variables and sex as a between-subjects factor ... startle timing program methodologically imposes a critical time constraint on information processing Lang and associates [26] speculated that a startle stimulus, initiated at the right ear, fails...
- 6
- 432
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25