a comparison among ekf with bias tracking cubature pf and cost reference pf
Forecasting UK GDP growth, inflation and interest rates under structural change: a comparison of models with time-varying parameters potx
... TVP-VAR (General) TVP-VAR (Standard) TVP-VAR (Homoscedastic) TVP-FAVAR TVP-FAVAR (Homoscedastic) FAVAR UC TVAR (GDP) TVAR (Inflation) TVAR (Rate) ST-VAR (GDP) ST-VAR (Inflation) ST-VAR (Rate) VAR ... models that incorporate a gradual change in parameters and also include a large set of explanatory variables particularly well as far as the inflation forecast is concerned recording gains (over ... Time-varying parameters, stochastic volatility, VAR, FAVAR, forecasting, Bayesian estimation JEL classification: C32, E37, E47 (1) External MPC Unit Bank of England Email: alina.barnett@bankofengland.co.uk...
- 56
- 469
- 1
Báo cáo khoa học: "Volumetric modulated arc therapy is superior to conventional intensity modulated radiotherapy a comparison among prostate cancer patients treated in an Australian centre" pps
... contouring, plan acceptance and to see the patients in follow up; the costs of the different linear accelerators (as all new modern linear accelerators are now capable of 3D, IM and VMAT); and costs ... therapy-but not as a result of distance Intern Med J 2010, 40(2):126-32 Kenny L, Lehman M: Sequential audits of unacceptable delays in radiation therapy in Australia and New Zealand Australas Radiol 2004, ... article as: Fogarty et al.: Volumetric modulated arc therapy is superior to conventional intensity modulated radiotherapy - a comparison among prostate cancer patients treated in an Australian...
- 5
- 288
- 0
Exposure generated by cough released droplets in the indoor environment a comparison among four ventilation systems
... lower than that with MV for 0.1, 1.0, 2.5, and 5μm particles, but larger for 10 and 20μm particles With UF the vertical stratification for 0.1, 1.0, and 2.5μm particle also appears and human exposure ... interaction among: cough flow, room flow generated with air delivery system at a particular supply air flow rate, convective boundary layer around heated human body and inhalation/exhalation ... Nicas et al (2005) was proposed in such a way that expelled particles with da≤20μm have the ability to evaporate quickly and constitute the inhaled particles with da≤10μm Because the rate of particle...
- 298
- 204
- 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved the final manuscript ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation...
- 6
- 300
- 0
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved the final manuscript ... clinical samples, follow-up clinical information and final writing of the manuscript VM, SS, PC and EB participated in acquiring clinical and laboratory data, data analysis and data interpretation...
- 6
- 312
- 0
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot
... subband corruption (a ecting subbands and 3, and 4, and and 5, resp.), and two cases with three subband corruption (a ecting subbands 2, 3, and 4, and subbands 3, 4, and 5, resp.) With the above ... and conditional union model (CU), in stationary bandselective noise with 1-subband, 2-subband, and 3-subband corruption within subbands modeled by 10 feature streams (5 static and delta subband ... model, for an utterance with 1-subband corruption at SNR = 10 dB (a) (A1 , B), and tested on one matched conversation (A2 , handset used in training data) and one mismatched conversation (C, handset...
- 12
- 323
- 0
Báo cáo lâm nghiệp: "A linkage among whole-stand model, individual-tree model and diameter-distribution model" ppsx
... estimates of stand variables at tree-level, Y S – estimates of stand variables at stand-level, ω w – weight factor, σ T – variance of stand variables at tree-level, σ S – variance of stand variables ... dominant height in m at age At, Nt = number of trees per at age At, Dgt = quadratic mean diameter in cm at age At, Dmt = arithmetic mean diameter in cm at age At, Bt = stand basal area in m2·ha–1 ... predict annual diameter growth and survival for an individual tree This method was based on the fact that rates of survival and diameter growth vary from year to year Stand-level growth and survival...
- 9
- 434
- 0
Báo cáo y học: "Biology of recently discovered cytokines: Interleukin-17 – a unique inflammatory cytokine with roles in bone biology and arthrits" pdf
... 11:2044-2055 Takaya H, Andoh A, Makino J, Shimada M, Tasaki K, Araki Y, Bamba S, Hata K, Fujiyama Y, Bamba T: Interleukin-17 stimulates chemokine (interleukin-8 and monocyte chemoattractant protein-1) ... osteoprotegerin ligand Nature 1999, 402:304-309 Nakashima T, Kobayashi Y, Yamasaki S, Kawakami A, Eguchi K, Sasaki H, Sakai H: Protein expression and functional difference of membrane-bound and soluble ... nuclear factor-kappaB and receptor activator of nuclear factor kappaB (RANK)/RANK ligand signaling? Bone 2001, 28:378-386 33 Witowski J, Pawlaczyk K, Breborowicz A, Scheuren A, KuzlanPawlaczyk...
- 8
- 384
- 0
Performance Studies on a Downdraft Biomass Gasifier with Blends of Coconut Shell and Rubber Seed Shell as Feedstock
... this gasifier as per supplier specification is wood chip A gas analyser, gas chromatograph and a gas flow meter are provided to measure the quality and quantity of the producer gas Calibrated ... downdraft gasifier with biomass energy sources available in remote villages, American Journal of Applied Sciences 11(2014) 611-622 [19] B Buragohain, P Mahanta, S Vijayanand, Moholkar, Investigations ... biomass throughout the year suffers with issues such as risk on transportation, non-availability of a particular biomass throughout the year and incomplete utilization of various biomasses available...
- 14
- 264
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Trajectory Patterns of Self-Rated Health among the Elderly in Taiwan: A Comparison across Ethnicity pptx
... Intergenerational Conflict." Ageing and Society 10: 377-396 Wang, F C 1993 "Causes and Patterns of Ethnic Intermarriage among the Hokkien, Hakka, and Mainlanders in Postwar Taiwan: A Preliminary Examination." ... and Mutran (2005) compared two measures of health status (self-rated health and functional and disability status) between the Mainlander and Taiwanese elders, finding significant health disparities ... Population Studies No 35 Mainlanders and Taiwanese elders is probably the lack of large-scale survey data Because of a dramatic decline in total fertility in Taiwan and the expectation of a rapid...
- 34
- 346
- 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx
... clinical trials During the baseline phase, study patients had to have an average daily diary pain score of at least (within the last days) on a numeric rating scale ranging from ("no pain") to ... medication up to and including Day1 If fewer than scores are available then baseline consists of all scores that are available Page of (page number not for citation purposes) Health and Quality ... Somnolence and MOS Awaken Short of Breath or with Headache; and no correlation with MOS Snoring Qualitative research among FM patients is underway to confirm these findings and to further understand...
- 7
- 597
- 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf
... UK and US weights for all known groups including HbA1c level (above and below 7%) and diabetic complications (presence and absence) namely neuropathy, retinopathy, nephropathy and cardiovascular ... analyzing and collecting the data All authors have read and approved the final manuscript Acknowledgements This research was supported by a grant from Chulalongkorn University The authors thank diabetic ... scores, and VAS scores using Spearman's rho correlation coefficients The sociodemographic and clinical characteristics are shown in Table The mean age was 61.6 years old (SD: 11.4; range: 27–90) and...
- 9
- 498
- 1
báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx
... initiated this paper as a part of a larger study of fracture patients, collected and analyzed the data and wrote the manuscript GH was the principal investigator for the research program in patients ... model and are particularly important in understanding general health perceptions and GQOL In addition, perceptions of health appear to Page of 11 (page number not for citation purposes) Health and ... GQOL like age, sex, education, marital status, clinical variables and health-focused QOL were adjusted for in the multivariate analysis Such adjustments allows for a more meaningful comparison of...
- 11
- 514
- 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc
... routine claims data and secondarily by drawing a random sample selection bias is unlikely AM designed and conducted the study and drafted the manuscript AR performed the data management, AR and KH ... Functional status, health problems, age and comorbidity in primary care patients Qual Life Res 2001, 10:141-148 Cavalcante MA, Bombig MTN, Filho BL, de Camargo Carvalho AC, de Paola AAV, Povoa R: Quality ... The authors are grateful to the AOK Sachsen-Anhalt and the AOK Rheinland-Pfalz for support in sending out the study material to their insured and for the preparation of claims data for sampling...
- 7
- 458
- 0
báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx
... sedimentation rate, and a general health assessment on a visual analog scale (VAS) [23] Disease activity in patients with AS and axial PsA was measured with the BASDAI [24] The BASDAI consists of VAS ... to evaluate disease activity in patients with RA and peripheral PsA and the Bath Ankylosing Spondylitis Disease Activity index (BASDAI) [24] was used for patients with AS and axial PsA DAS has ... RA SA Per PsA Ax PsA MH Controls RA SA Per PsA Ax PsA RE Controls RA SA Per PsA Ax PsA SF Controls RA SA Per PsA Ax PsA VT Controls RA SA Per PsA Ax PsA SF-36 PCS Controls RA SA Per PsA Ax PsA...
- 12
- 466
- 0
báo cáo hóa học: " Reaching in reality and virtual reality: a comparison of movement kinematics in healthy subjects and in adults with hemiparesis" pdf
... Digital Corp.) Each trial was divided in two phases: 1) reaching and grasping the ball and 2) ball transport and release For the first movement phase, temporal and spatial parameters of reaching and ... and rehabilitation specialists like physical and occupational therapists are beginning to be interested in VR as a tool to study motor control and to evaluate and treat motor deficits secondary ... McFadyen BJ, Feldman AG: Reaching in reality and in virtual reality: A comparison of movement kinematics [abstract] ISEK, Boston 2004 Gowland C, Stratford P, Ward M, Moreland J, Torresin W, Van...
- 7
- 476
- 0
báo cáo hóa học:" Do visual analogue scale (VAS) derived standard gamble (SG) utilities agree with Health Utilities Index utilities? A comparison of patient and community preferences for health status in rheumatoid arthritis patients" pptx
... by a grant from the Canadian Arthritis Network (a National Centre of Excellence) Dr Marra is supported by a Canadian Arthritis Network Scholar Award, and a Michael Smith Foundation for Health ... determine quality of life of an individual are captured and summarized as a global score In VAS and SG valuation methods, however, the individual evaluates his or her own health state based on a holistic ... directly "assesses" and "evaluates" a health state on a scale of 0.00 (death) to 1.00 (perfect health) The health states that are evaluated in the direct approach can be hypothetical or can be the...
- 10
- 603
- 0
báo cáo hóa học:" Health related quality of life among adolescents with premenstrual disorders: a cross sectional study" potx
... ghofranf@modares.ac.ir PA: azadfa_pa@modares.ac.ir SST: tavafian@modares.ac.ir AK: kazem_an@modares.ac.ir AM: montazeri@acecr.ac.ir * Corresponding authors Abstract Background: Premenstrual disorders ... Health related quality of life among adolescents with premenstrual disorders: a cross sectional study Mahin Delara1, Fazlollah Ghofranipour1*, Parviz Azadfallah1, Sedigheh Sadat Tavafian1, Anoushirvan ... was also designed in this part to evaluate the awareness of the students about premenstrual disorders Statistical analysis The data were analyzed in a descriptive fashion Also univariate analysis...
- 18
- 277
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose