a combination of symmetric and asymmetric encryption
Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx
... of PDI dye, and Prof Po-Da Hong and Prof Shawn D Lin (National Taiwan University of Science and Technology) for experimental support Author details International Iberian Nanotechnology Laboratory ... study and participated in its design and coordination, as well as in sample preparation and characterization by TEM, SEM and SAXS NV participated in TEM observations and in spectroscopic measurements ... Universidad de Santiago de Compostela, Santiago de Compostela, 15782, Spain 5Toyota Physical & Chemical Research Institute, Nagakute, Aichi, 4801192, Japan Additional material Additional file...
- 7
- 525
- 0
Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc
... the combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha monotreatment IFN-alpha was more effective than amantadine against the HAV ... Tomoko Kiyohara, Tatsuo Kanda and FI analyzed data and wrote the manuscript Tomoko Kiyohara, KI and TW contributed to experiments using a whole HAV virus Tomoko Kiyohara, Tatsuo Kanda and VG contributed ... we evaluated the HAV antiviral activity of amantadine and IFN-alpha We initially examined the effects of this combination on HAV IRES-mediated translation using a luciferase reporter assay Huh7...
- 5
- 301
- 0
A study of symmetric and repetitive structures in image based modeling
... The parameters contained in K are called the intrinsic camera parameters and the six degrees of freedom contained in R and C are called the extrinsic camera parameters CCD cameras The ideal pinhole ... global translation estimation In fact, each pair-wise camera poses differ from the global camera poses by a scale sij and translation tij after global rotation alignment in the first stage Given pair-wise ... located at z = f The line from the camera center and perpendicular to the image plane is called the principal axis or principal ray of the camera The intersection of principal axis and the image...
- 176
- 1,008
- 0
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... method Sadao Kurohashi and Makoto Nagao 1994 Kn parser: Japanese dependency/case structure analyzer In Proceedings of the Workshop on Sharable Natural Language Resources, pages 48–55 Sadao Kurohashi ... models Transactions of Information Processing Society of Japan, 40(9):3397–3407 (in Japanese) Andrew Kehler, Douglas Appelt, Lara Taylor, and Aleksandr Simma 2004 The (non)utility of predicate-argument ... 719–724 Sadao Kurohashi and Makoto Nagao 1998b Japanese Morphological Analysis System JUMAN version 3.5 Department of Informatics, Kyoto University (in Japanese) References Eugene Charniak and Mark...
- 8
- 481
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access ... introduction of error and loss of time efficiency Nowadays, the use of computers and statistical programmes is fairly standard for the analysis of quantitative data Aside from common database and statistical ... appraisal The origins of rapid market appraisal (RMA) are similar to those of rapid rural appraisal (RRA), in that formal surveys were often seen as lengthy, costly and management intensive As a...
- 95
- 645
- 0
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx
... protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG The annealing site for the upstream ... in gauche position relative to the first, hydrogen-bonded to one of the ˚ aspartates (2.8 A) and had van der Waals interaction with ˚ Cb of Ala28 (Ala128) at a distance of 3.9 A The same arrangement ... calculated with a maximum distance of 3.5 A between acceptors and donors An atom/pair distance of less than 3.9 A was used as criterion for a contact Compound Molecular mass (Da) Buried surface ˚ area...
- 13
- 438
- 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx
... grammatical analysis of Portuguese in a constraint grammar framework 2nd International Conference on Language Resources and Evaluation, Athens, Greece TELRI J P Chanod and P Tapanainen 1995 Tagging ... the fact that they not use the standard evaluation techniques (and not even the same data) But the substantial disadvantage is that the development of manual rule-based systems is demanding and ... Morphological tagging: Data vs dicc tionaries In Proceedings of the NAACL’00, Seattle, WA, pages 94–101 ACL Jan Hajiˇ and Barbora Hladk´ 1997 Tagging of inc a flective languages: a comparison In Proceedings...
- 8
- 518
- 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... the amide nitrogen atoms of the drug and the N3 and O2 atoms of A and T base pairs, respectively, clearly cataloging the structure to class I As the additional bulky NH2 group of GC base pairs at ... geometry based on HF ⁄ 6–31G* calculations of the interaction between (A) the amidinium end and bases A2 5, T8 and G9; and (B) the guanidinium end and bases A5 , T28 and A6 Intermolecular geometry ... was investigated by evaluating the interaction energies and hydrogen positions of the end fragment and the bases of base pair T8 -A2 5 and base G9 (Table 2, Fig 4) For the bases of the A2 5-T8 base...
- 11
- 483
- 0
Báo cáo khoa học: "A Combination of Active Learning and Semi-supervised Learning Starting with Positive and Unlabeled Examples for Word Sense Disambiguation: An Empirical Study on Japanese Web Search Query" pdf
... unlabeled examples is effective The accuracies of with-EM, random and without-EM are gradually increasing according to the percentage of added hand labeled examples and catch up that of human and ... in table Human labeling, abbreviated as human, is an active learning approach starting with human labeled negative examples The number of hu- 63 man labeled negative examples in initial training ... negative dataset ) 13 end Full text query for initial positive examples Wega Loft Wega AND TV Loft AND (Grocery ORStationery) Honda AND Keisuke Tsubaki AND Shiseido Honda Tsubaki Loft store name...
- 4
- 441
- 1
Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems " doc
... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... locations of the sensors The time delay is taken with 1/500 and 1/800 of total duration time T Some of the controlled results are shown in table and Fig and In Fig and 7, thin and dotted lines are ... as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section...
- 8
- 359
- 0
Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc
... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... locations of the sensors The time delay is taken with 1/500 and 1/800 of total duration time T Some of the controlled results are shown in table and Fig and In Fig and 7, thin and dotted lines are ... as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration The characteristics of the beam are taken from [12] The beam has a square cross-section...
- 8
- 416
- 0
Báo cáo hóa học: " A Novel Method to Fabricate Silicon Nanowire p–n Junctions by a Combination of Ion Implantation and in-situ Doping" docx
... calculated the depletion width [20] as 40 nm This value is significantly smaller than the average Fig An illustration of how the p–n junction is formed in a Si NW a An SEM image of a NW indicating ... heavy mass compared to phosphorus, the Au caps on top of the NWs were removed (Fig 1c) by an aqueous solution of KI and I2, a standard Au etchant This resulted in the reduction in the average length ... were 45 and 25 keV corresponding to doses of 1.3 1014 and 123 Fig The scheme of fabricating axial p–n junction Si NWs a An as-grown p–i NW b scanning electron microscope (SEM) image of an as-grown...
- 4
- 332
- 0
Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx
... Engineering, Academic Press, New York, NY, USA, 1979 19 S.-H Wu, “Generalization and sharpness of the power means inequality and their applications,” Journal of Mathematical Analysis and Applications, ... mean values,” Journal of Convex Analysis, vol 15, no 4, pp 707–718, 2008 17 G D Anderson, M K Vamanamurthy, and M Vuorinen, “Generalized convexity and inequalities,” Journal of Mathematical Analysis ... and 1.7 , 4.21 Journal of Inequalities and Applications 15 Acknowledgment This work was supported by the National Science Foundation of China no 60850005 and the Natural Science Foundation of...
- 15
- 301
- 0
Báo cáo y học: "A combination of autoantibodies to cyclic citrullinated peptide (CCP) and HLA-DRB1 locus antigens is strongly associated with future onset of rheumatoid arthritis" potx
... Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, ... study, calculations are based on the combination of SE and the analysed autoantibodies This is because anti-CCP antibodies and RFs are significantly associated, and consequently prediction of RA is ... or an RF of any isotype, in comparison with individuals not having any of the factors or having any one of them separately In particular, the combination of SE gene carriage and the presence of...
- 6
- 364
- 0
Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf
... fractured surface of articular cartilage after trauma or transplantation The objective of this study was to investigate the initiation of immediate bonding of articular cartilage blocks by means of combining ... strength of kPa Determination of glycosaminoglycan and collagen content To assess the effects of the surface degradation treatment, the extracellular matrix content of cartilage blocks was analysed after ... Breevaart BJ, In der Maur CD, Bos PK, Feenstra L, Verhaar JA, Weinans H, van Osch GJ: Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation...
- 11
- 476
- 0
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx
... Department of Medical Research of Mackay Memorial Hospital HYL, WT, and YH are professors from National Taiwan University, National Taipei University of Technology, and Taipei Medical University, ... pharmacophore model used as the 3D query in database searching was retained as a hit Two database searching options such as Fast/Flexible and Best/Flexible search are available in DS V2.5.5 Of these two, ... Bartolini M, Cavalli A, Tarozzi A, Andrisano V, Minarini A, Rosini M, Tumiatti V, Bergamini C: Novel class of quinonebearing polyamines as multi-target-directed ligands to combat Alzheimer’s disease J...
- 13
- 389
- 0
Báo cáo khoa học: "A Combination of Atrioventricular Block and Sinoatrial Block in a Horse" ppt
... T, Hasegawa M, Tomioka Y: Cardiopathology of sinoatrial block in horses Jap J Vet Sci., 1985, 47, 45-54 Matsui K, Amada A, Sawazaki H: Second -degree 175 atrioventricular block observed in a Thoroughbred ... (Smetzer 1967) Although AVB and SAB may occur simultaneously on the ECG of a horse their association is very rare A review of literature showed that only one case has been reported in a doctral thesis ... and vagally mediated cardiac dysrythmias are more comActa vet scand vol 46 no 3, 2005 mon in trained horses although AVB has also been reported in a 2.5 months thoroughbred foal (Matsui et al 1988).There...
- 3
- 230
- 0
Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot
... 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM ... was knocked-down using a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3' p53: 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG ... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' http://genomebiology.com/2005/6/5/R43...
- 8
- 248
- 0
A Novel Combination of Negative and Positive Selection in Artificial Immune Systems
... (Figure 2 .a) , the detector candidates are generated by some random processes and matched against the given self sample set S The candidates that not match any element in S are eliminated and the ... this paper, we assume binary representation for all detectors and data Binary representation is the most simple and popular representation for detectors and data in AIS, and other representations ... incoming data instance matches any detector, it is claimed as non-self or anomaly Begin Begin Generate Random Candidates Input new samples Yes Match self samples? Match any detector? No No Accept as...
- 10
- 353
- 0
Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"
... secondary prevention of stroke with APS, and compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy in ischemic stroke patients with APS The subjects were ... promising, and a larger study with more patients would be warranted Conclusion Our results indicate that a combination of antiplatelet and anticoagulation therapy may be more effective than single antiplatelet ... 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with APS According...
- 4
- 601
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25