a caucus race and a long tale

Natural botanical products have a long history in the world and are featured in using a complex

Ngày tải lên : 03/11/2012, 09:54

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the longest ... biological parameters in tumorigenesis including cell proliferation and apoptosis [7], and also angiogenesis [8] were assessed in gastric tumors after drug treatment Materials and methods Chemicals and...

9
712
0

Get a Life, Not a Job: Do What You Love and Let Your Talents Work For You

Ngày tải lên : 16/03/2014, 21:45

... S .A de C.V Pearson Education—Japan Pearson Education Malaysia, Pte Ltd Library of Congress Cataloging-in-Publication Data Caligiuri, Paula Get a life, not a job : what you love and let your talents ... organizations that are unable to afford a fulltime grant writer Jay and Dan both leveraged their expertise and talent, extending their reach to create additional career acts If you really cannot ... this ideal job? • What are the paths to reach the goal of that ideal job? Name your talents: • What are you good at—what others say you are good at? • How could I be paid and leverage my talents?...

205
536
0

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Ngày tải lên : 23/03/2014, 04:20

... is endocytosed via a clathrin- and caveolinindependent pathway, whereas BPV1 and HPV31 were shown to enter via clathrincoated pits and caveolae, respectively Additional details are provided in ... Sapp and M Bienkowska-Haba on the match between codon usage and tRNA availability J Virol 73, 4972–4982 Buck CB, Pastrana DV, Lowy DR & Schiller JT (2004) Efﬁcient intracellular assembly of papillomaviral ... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope...

11
511
0

Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from ﬁssion yeast Dps1 and budding yeast pptx

Ngày tải lên : 30/03/2014, 04:20

... obtained from TOYOBO (Osaka, Japan) and New England Biolabs Japan (Tokyo, Japan) Protein markers were obtained from Fermentas Life Sciences (Ontario, Canada) and Oriental Yeast (Tokyo, Japan) Antibodies ... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... functional expression in Escherichia coli and Saccharomyces cerevisiae J Bacteriol 179, 5992–5998 20 Okada K, Kainou T, Tanaka K, Nakagawa T, Matsuda H & Kawamukai M (1998) Molecular cloning and mutational...

16
315
0

global and national macroeconometric modelling a long-run structural approach oct 2006

Ngày tải lên : 11/06/2014, 05:36

... Statistical Association (Chapters and 11) and Journal of Econometrics (Chapter 6) And the project has also been assisted greatly by the contributions of Yoga Affandi, Mutita Akusuwan, Mahid Barakchian, ... incorporate features such as adjustment costs (e.g Kydland and Prescott, 1982, Christiano and Eichenbaum, 199 2a, and Cogley and Nason, 1995); signal extraction and learning (e.g Kydland and Prescott, ... invaluable comments from Manuel Arrelano, Michael Binder, Carlo Favero, Paul Fisher, Clive Granger, David Hendry, Cheng Hsiao, George Kapetanios, Adrian Pagan, Bahram Pesaran, Til Schuermann, James...

397
451
0

$báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf$

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf

Ngày tải lên : 20/06/2014, 04:20

... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation, ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment...

10
427
0

$báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx$

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx

Ngày tải lên : 20/06/2014, 07:20

... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation, ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment...

10
335
0

Báo cáo y học: "A long-term follow-up of a girl with dilated cardiomyopathy after mitral valve replacement and septal anterior ventricular exclusion" docx

Ngày tải lên : 10/08/2014, 10:20

... functional class, who not respond to medical therapy, are candidates for heart transplantation In addition to the shortage of available organs, there are legal, economical, ethical and technical problems ... uptake was decreased from the anterior part of the IVS and anterior wall of the LV on cardiac scintigraphy (Arrow: Anterior wall of LV, Arrowhead: Anterior part of IVS) Randas Batista et al described ... Bakris GL, Cohen JD, Parmley WW: A calcium antagonist vs a non-calcium antagonist hypertension treatment strategy for patients with coronary artery disease The International Verapamil-Trandolapril...

3
359
0

Báo cáo y học: " A systematic review of personality disorder, race and ethnicity: prevalence, aetiology and treatment" docx

Ngày tải lên : 11/08/2014, 16:22

... prevalence data suitable for meta-analysis (additional file 1) [814] All seven studies contained data for black and white participants; in total there were 10356 black participants, and 29954 white participants ... disproportionately more BPD than Caucasians (p < 0.001) and African Americans (p < 0.01) For STPD, African Americans had disproportionately more diagnoses than Caucasians (p < 0.05 and Hispanics (p < 0.05 ... systematically such that PD diagnosis were applied to certain ethnic grps African American given Antisocial & paranoid PDs Schizoid PD applied to Asian Americans Schizotypal PD applied to Native Americans...

14
430
0

Báo cáo khoa học: " A long-term follow-up study investigating health-related quality of life and resource use in survivors of severe sepsis: comparison of recombinant human activated protein C with standard care" pot

Ngày tải lên : 13/08/2014, 10:20

... approximately 140 standard care patients We anticipated an attrition rate of 20%, resulting in a final target sample size based of approximately 56 APC patients and 112 patients in the standard ... next of kin was obtained To avoid an imbalance between APC and standard care patients from each site, each participating site enrolled in blocks of three APC and six standard care patients Sites ... physical, bodily pain, general health, vitality, social function, role emotional and mental health) and resource utilization measures A longitudinal as well as across treatment comparison was undertaken...

11
376
0

Báo cáo y học: "Correction: A long-term follow-up study investigating healthrelated quality of life and resource use in survivors of severe sepsis: comparison of severe sepsis: comparison of recmbinant human activated protein C with standard care" pot

Ngày tải lên : 13/08/2014, 11:23

1
221
0

Báo cáo y học: " Cable properties and propagation velocity in a long single chain of simulated myocardial cells" docx

Ngày tải lên : 13/08/2014, 16:21

... contain fast Na+ channels at a higher density than that in the surface sarcolemma [9,15,16] Transverse propagation also occurred by the same EF mechanism between adjacent parallel chains that ... equivalence of physiological parameters A simulation study by PSpice can be made as accurate as using the mathematical model Additionally, PSpice provides the ability to vary the parameters at a ... Propagation of simulated action potentials (APs) in a single linear chain of 100 myocardial cells Figure Propagation of simulated action potentials (APs) in a single linear chain of 100 myocardial...

11
326
0

Movement patterns and residence of adult winter flounder within a long island estuary

Ngày tải lên : 04/09/2015, 17:09

... and preparation of adult winter ﬂounder. A trawl survey with a stratiﬁed random sampling design was conducted bimonthly during daylight between April and August 2007 and monthly between May and ... May and August, when bottom water temperatures exceeded 15◦ C In contrast, ocean surveys conducted in coastal waters of Long Island (10–30-m depths) and areas adjacent to Shinnecock Bay indicated ... seals Pagophilus groenlandica in the bay—particularly in the high-density area—between November and May (USFWS 1997) Thus, appearance of these seasonal predators may be placing additional pressure...

13
451
0

Dynamics and characterisation of membrane fouling in a long reverse osmosis membrane channel

Ngày tải lên : 15/09/2015, 17:10

... driving factors (Mallevialle et al 1996; AWWA 1999; Bremere et al 2001) make RO an attractive process in water treatment and reclamation In addition, RO has many advantages over conventional separation ... organic polymeric materials, the two most important materials are cellulose acetate (CA) and polyamide (PA) (AWWA 1999; Baker 2000) CA membranes are low in cost and are hydrophilic They have ... separation processes Today RO is widely used for separation and concentration of solutes in many fields, such as chemical and biomedical industry, food and beverage processing, and water and wastewater...

180
343
0

Oliver twist, a fairy tale in modern times

Ngày tải lên : 20/12/2013, 22:01

... feudalism Authors of fairy tale used fairy and fictitious imagination to reflect social life, peoples aspirations, and meeting demand of awareness, aestheticism and entertainment Folk tales are ... my young heart to believe that, day by day, what I had learned and thought and delighted in, and raised my fancy and my emulation up by, was passing away from me'' On the contrary, Charles Dickens's ... the contrary, there are some good and gentle characters, such as Miss Rose, Mr Brownlow and Mrs Maylie They are real character but they are also the image of male and female in fairy tales When...

44
387
1

Tài liệu Pension Fund Indicators 2012 A long-term perspective on pension fund investment docx

Ngày tải lên : 19/02/2014, 14:20

... business areas are Alternative and Quantitative Investments, Global Real Estate, Infrastructure, Private Equity and Fund Services UBS Global Asset Management combines investment expertise and attention ... specialist mandates can be run on an active or passive basis Global Investment Solutions (GIS) covers asset allocation, currency, manager research and risk management Our other investment and ... real estate? Gaining exposure to real estate Real estate derivatives Key benefits and challenges of investing in real estate Global real estate investment The UK and European real estate markets...

12
359
0

Tài liệu Báo cáo khoa học: "Tokenization: Returning to a Long Solved Problem" pdf

Ngày tải lên : 19/02/2014, 19:20

... #2006T13) and OntoNotes (Hovy et al., 2006) Clearly, as one moves towards a more application- and domaindriven idea of ‘correct’ tokenization, a more transparent, flexible, and adaptable approach to ... track of character start and end positions as offsets between a string before and after each rule application (i.e all pairs I, O ), and these offsets are eventually traced back to the original ... other abbreviations, oddly), an extra period is hallucinated, so the abbreviation also has one In contrast, C&J add a period to all final abbreviations, CoreNLP groups the final period with a final abbreviation...

5
461
0

Assuring Access in Key Strategic Regions - Toward a Long-Term Strategy docx

Ngày tải lên : 15/03/2014, 20:20

... anti-access study with us xxi Glossary AB AMC APOD APOE APS ARCENT ARPAC ARSOUTH ASAT ASW ATACMS AWACS BCT C2 CBRNE CENTCOM CEP CONUS EMP Air Base Air Mobility Command Aerial Point of Debarkation ... • “Anti-Access in a Baltic Scenario,” 2003; “Anti-Access in a SWA Scenario,” 2003; “Anti-Access in a PRC-Taiwan Scenario,” 2003; and “Anti-Access Strategies: A Quantitative Analysis of Military ... to APODs and SPODs, and onward movement toward the tactical area Our assumption was that, in theory at least, an adversary could direct attacks or other actions against any of the nodes or arcs...

187
251
0

The raman effect a unified treatment of the theory of raman scattering by molecules derek a long

Ngày tải lên : 17/03/2014, 14:46

... Rotations A1 4.7 Isotropic Averages and Tensor Invariants A1 4.7.1 General considerations A1 4.7.2 Isotropic averages and rotational invariants G j in terms j of the ˛m A1 4.7.3 Isotropic averages and ... rotational invariants G j in terms of the ˛ A1 4.7.4 Isotropic averages and rotational invariants G j in terms of the ˛ A1 4.7.5 Isotropic averages and the rotational invariants G j , a, υ and ... 564 A2 1 Polarization of Electromagnetic Radiation A2 1.1 Introduction A2 1.2 States of Polarization: Monochromatic Radiation A2 1.2.1 Linear polarization A2 1.2.2 Elliptical and circular polarization...

611
443
0

Low Occurrence of Tuberculosis Drug Resistance among Pulmonary Tuberculosis Patients froman Urban Setting, with a Long-Running DOTS Programin Zambia docx

Ngày tải lên : 22/03/2014, 18:20

... contributions made to this paper by Webster Kasongo and David Mwakazanga at the Tropical Diseases Research Centre, Zambia in study coordination and data analysis, respectively Finally, the authors thank ... strains from Sierra Leone,” BMC Microbiology, vol 8, article no 103, 2008 [22] J S Jarallah, A K Elias, M S Al Hajjaj, M S Bukhari, A H M Al Shareef, and S A Al-Shammari, “High rate of rifampicin ... American Journal of Respiratory and Critical Care Medicine, vol 152, no 3, pp 1067–1071, 1995 G Ramachandran, A K H Kumar, C Padmapriyadarsini, et al., “Urine levels of rifampicin & isoniazid in asymptomatic...

6
329
0