a business framework for the governance and management of enterprise it

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Ngày tải lên : 20/06/2014, 08:20
... increased collaboration and integration of TB and HIV programs and services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional Healthcare Providers A critically ... feasibility of various collaborative and integrative efforts at the healthcare delivery level in urban and rural areas have been carried out or are ongoing In Rwanda, integration of TB and HIV ... TB and HIV programs is usually situated within the structure of National Ministries of Health, there is the opportunity for these latter institutions to play a critical role in establishing and...
  • 5
  • 469
  • 0
A framework for the analysis and assessment of accountability arrangements in the public domain

A framework for the analysis and assessment of accountability arrangements in the public domain

Ngày tải lên : 11/12/2016, 11:11
... about the quality of the provision of information by the actor, the quality of the procedure, and the quality of the forum’s judgement, afford a framework for a normative analysis of accountability ... the Polluter Accountability Act, the Syria Accountability Act, and the United Nations Voting Accountability Act The use of the term ‘accountability’ is usually limited to the title of these acts ... forum could therefore also apply a collective strategy of accountability and pick any member of the organisation and hold it personally accountable for 18 the conduct of the organisation as a...
  • 37
  • 535
  • 0
GUIDELINES FOR THE ISSUANCE AND MANAGEMENT OF EXTENDED VALIDATION CERTIFICATES doc

GUIDELINES FOR THE ISSUANCE AND MANAGEMENT OF EXTENDED VALIDATION CERTIFICATES doc

Ngày tải lên : 16/03/2014, 00:20
... scenario Period of coverage AICPA standards Management s assertion Unqualified report CICA standards Management s assertion Unqualified report International standards Management s assertion Unqualified ... that any of the information appearing in the EV Certificate is not accurate • the CA ceases operations for any reason and has not arranged for another EV CA to provide revocation support for the ... express an opinion based on our audit Our audit was conducted in accordance with standards for assurance engagements established by the Canadian Institute of Chartered Accountants (CICA) and, accordingly,...
  • 32
  • 425
  • 0
Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma docx

Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma docx

Ngày tải lên : 17/03/2014, 15:20
... AND ABBREVIATIONS AAI A artemisiifolia ABG ABPA ACE ACIP ACT AHRQ ALT Amb a AQLQ ATAQ ATS acute asthma index Ambrosia artemisiifolia arterial blood gas allergic bronchopulmonary aspergillosis angiotensin ... PATHOPHYSIOLOGY AND PATHOGENESIS, AND NATURAL HISTORY FOR ASTHMA MANAGEMENT Airway inflammation is a major factor in the pathogenesis and pathophysiology of asthma The importance of inflammation to central ... pathophysiology and pathogenesis of asthma, and the natural history of asthma Definition of Asthma Asthma is a common chronic disorder of the airways that is complex and characterized by variable...
  • 440
  • 728
  • 0
CA/Browser Forum Baseline Requirements for the Issuance and Management of Publicly-Trusted Certificates, v.1.0 pot

CA/Browser Forum Baseline Requirements for the Issuance and Management of Publicly-Trusted Certificates, v.1.0 pot

Ngày tải lên : 31/03/2014, 13:20
... Protect the confidentiality, integrity, and availability of Certificate Data and Certificate Management Processes; Protect against anticipated threats or hazards to the confidentiality, integrity, and ... The CA SHALL encrypt its Private Key with an algorithm and key-length that, according to the state of the art, are capable of withstanding cryptanalytic attacks for the residual life of the encrypted ... confidentiality of the Key Pair For other CA Key Pairs created after the Effective Date that are for the operator of the Root CA or an Affiliate of the Root CA, the CA SHOULD: prepare and follow a Key...
  • 35
  • 511
  • 0
Guidelines for the Diagnosis and Management of Food Allergy in the United States docx

Guidelines for the Diagnosis and Management of Food Allergy in the United States docx

Ngày tải lên : 31/03/2014, 13:20
... Food Allergy, Prevalence, and Associated Disorders Diagnosis of Food Allergy 19 Management of Nonacute Allergic Reactions and Prevention of Food Allergy 25 Diagnosis and Management of Anaphylaxis ... Guidelines and was not considered by the expert panel Please check with your healthcare professional for specific guidance DIAGNOSIS AND MANAGEMENT OF ANAPhYLAxIS CAUSED BY FOOD Diagnosis and Management ... 2-year effort in which the National Institute of Allergy and Infectious Diseases (NIAID), part of the National Institutes of Health, worked with 34 professional organizations, federal agencies, and...
  • 36
  • 581
  • 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Ngày tải lên : 18/06/2014, 22:20
... GTGGTGGATTTTGCCAGCTTGTACCCCAGTATCATCCAAGCGCACAACTTGTGC GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC ... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC GTGGTGGATTTTGCCAGCTTGTACCCCAGTATCATCCAAGCGCACAACTTGTGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
  • 24
  • 604
  • 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Ngày tải lên : 21/06/2014, 20:20
... has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information ... However, limited dynamic range of the CCD and quantization in the Analog/Digital conversion often lead to data loss that typically appears as saturation 6 EURASIP Journal on Image and Video Processing ... Gaussian stripes The initial pass is captured with only the display device in the scene to acquire a base case for the Gaussian parameters σ and X0 The next pass of the stripes is captured with...
  • 13
  • 569
  • 0
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Ngày tải lên : 08/08/2014, 21:20
... cases of AS (28 children and adults) AS was confirmed with an ACTH stimulation test in the large majority of cases (29) and by other measures of adrenal function in the remaining cases All cases ... London, Ontario, Canada 3McMaster University, Hamilton, Ontario, Canada 4University of Calgary, Alberta Children’s Hospital, Calgary, Alberta, Canada Authors’ contributions AA contributed to the conception, ... advantageous for the oral bioavailability of an ICS to be relatively low The oral bioavailability of the currently available ICSs varies widely, from approximately
  • 12
  • 774
  • 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

Ngày tải lên : 11/08/2014, 05:22
... Italy: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care Research, University of ... Hôtel Dieu, Paris Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto ... by a small sample size, the limited representativeness of participants, the lack of a comparison, and the assessment of intermediate outcomes For example, we have not evaluated the impact of the...
  • 7
  • 429
  • 0
INTERNATIONAL CONVENTION FOR THE CONTROL AND MANAGEMENT OF SHIPS BALLAST WATER

INTERNATIONAL CONVENTION FOR THE CONTROL AND MANAGEMENT OF SHIPS BALLAST WATER

Ngày tải lên : 25/04/2016, 17:03
... of Ballast Water Management and standards to prevent, minimize and ultimately eliminate the transfer of Harmful Aquatic Organisms and Pathogens through the control and management of ships‘ Ballast ... Annex: —Anniversary date“ means the day and the month of each year corresponding to the date of expiry of the Certificate —Ballast Water Capacity“ means the total volumetric capacity of any tanks, ... of each Ballast Water operation This includes discharges at sea and to reception facilities Ballast Water and Ballast Water Management —Ballast Water“ means water with its suspended matter taken...
  • 38
  • 614
  • 0
Guideline for the evaluation and management of status epilepticus (SE) 2012 (the neurocritical care society)

Guideline for the evaluation and management of status epilepticus (SE) 2012 (the neurocritical care society)

Ngày tải lên : 14/11/2016, 06:25
... emergent, targeted treatment to reduce patient morbidity and mortality These guidelines were developed to address evaluation and management of SE in critically ill adults and children and will not address ... stop spontaneously Animal data suggest that permanent neuronal injury and pharmacoresistance may occur before the traditional definition of 30 of continuous seizure activity have passed More ... nonrandomized and observational analyses C Evidence relies on expert/ consensus opinion, case reports,or standard of care Critical care treatment Critical care treatment Non-invasive airway protection and...
  • 18
  • 321
  • 0
Guideline for the diagnosis  and management of  hypertension in adults

Guideline for the diagnosis and management of hypertension in adults

Ngày tải lên : 15/11/2016, 12:08
... Rural Practitioners Association Standard Treatment Manual www.carpa.org.au • Diabetes Australia and the Royal Australian College of General Practitioners (RACGP) General practice management of type ... clear that the beneits outweigh the drawbacks/harms National Heart Foundation of Australia Guideline for the diagnosis and management of hypertension in adults 2016 Table 1.2 National Health and ... Aboriginal and Torres Strait Islander patients In accordance with the Central Australian Rural Practitioners Association Standard Treatment Manual, it is recommended to add 5% to the calculated risk...
  • 84
  • 595
  • 0
Building a business strategy for the retail consulting division of vietmai solutions

Building a business strategy for the retail consulting division of vietmai solutions

Ngày tải lên : 02/07/2017, 07:59
... organizations It was also the Chair of the Association of Southeast Asian Nations and the host of several important international events Regarding to the institutional framework, though its administrative ... support activities Allocate cost to each activity Activity cost information provides managers with valuable insight into the internal capabilities of an organization Identify the activities that are ... Strategy is a deliberated search for a plan of action that will develop a business s competitive advantage and compound it For any company, the search is an iterative process that begins with...
  • 91
  • 274
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20
... changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management and externalities has a ... Marketing Social Change San Francisco, CA: Jossey-Bass Publishers a good understanding of and accommodate the target's MOAs and the trade-off of free choice and externalities The potential for ... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments...
  • 14
  • 780
  • 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Ngày tải lên : 20/02/2014, 19:20
... to be formed In case the source of the reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser ... increase the recall of a pre-parser speech identifier by 4.8% Another advantage of giving speech repair information to the parser is that the parser can then include reparanda in its output and a ... hypothetical start and end of a reparandum (say from a language model such as (Heeman and Allen, 1997)), extends copies of phrase hypotheses over the reparandum allowing the corrected utterance...
  • 8
  • 486
  • 0
báo cáo hóa học: " A protocol for the emergency department management of acute undifferentiated febrile illness in India" potx

báo cáo hóa học: " A protocol for the emergency department management of acute undifferentiated febrile illness in India" potx

Ngày tải lên : 21/06/2014, 00:20
... protocol, if an eligible patient was stable and had had less than days of fever, all investigations and antimicrobial therapy were deferred, and the patient was prescribed antipyretics and asked to ... Protocol for the management of adult patients with acute undifferentiated fever Page of patients were managed either by the protocol or as deemed most appropriate by the evaluating physician Under the ... localizing symptoms The overarching goal of the protocol was to standardize the approach to such patients in a way that reduced unnecessary testing and inappropriate use of antibiotics Additional...
  • 4
  • 342
  • 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx

Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx

Ngày tải lên : 09/08/2014, 07:21
... lymphomas, one of the important roles of FNAC is the exclusion of metastatic squamous carcinoma as this requires an alternative therapeutic approach There is a question as to the accuracy of FNAC ... developed the concept, and prepared the draft manuscript PC and SK provided the pathological data and helped in preparing the manuscript, AV and TGH reviewed and edited the manuscript and helped ... in Wales with a ratio of 1:4 [1] Table 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal Supraclavicular...
  • 4
  • 435
  • 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps

Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps

Ngày tải lên : 10/08/2014, 09:21
... along the bronchial trees Therefore cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage ... 0.01) Page of HRCT imaging of the chest was developed to allow for improved diagnostic accuracy, sensitivity, and specificity for the evaluation of the pathology of lung parenchymal disease The ... operation and inspection of ELCs was performed as follows: After inducing general anaesthesia with a double lumen intubation, the patient was placed in the lateral position on the operating table with...
  • 5
  • 657
  • 0