a boolean dynamic model based on the t lgl leukemia survival signaling network
Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc
... associated to Emin , but generally Emin = so that this node contains the entire image The sons of the top node are the connected components CCE extracted in the father color set Then, after computation ... Flowchart of the computation of the color topographic map The image is thresholded with the current parameter E to obtain the color set N Then, N connected components are extracted On each of them ... material, and from its scattering by the pigments of the object It depends on the wavelength λ and on the physical characteristics of the considered material Theoretically, the dichromatic reflectance...
- 14
- 343
- 0
Development of a two dimensional wave model based on the extended boussinesq equations
... incompressible and inviscid And the rotational effect of the Earth is not taken into consideration The x - and y -axes represent two horizontal coordinates, while the z -axis is the vertical coordinate Then, ... (1993) are suitable to simulate wave propagation from relative deep to shallow water The equations contain all shoaling, refraction, diffraction and reflection effects in a variable depth As a compromise ... In contrast, by defining the dependent variable as the velocity at an arbitrary depth, Nwogu (1993) achieved a rational polynomial approximation to the exact linear dispersion relationship without...
- 121
- 285
- 0
LAKE EUTROPHICATION MODEL BASED ON THE IMPACT OF THE ZOOPLANKTON COMMUNITY ON PHYTOPLANKTON SUCCESSION
... Omaezaki weather station (about 20 km away from the pond) was utilized for calculating the daylight fraction The latitude of the observation site (34˚47') was used to calculate the daily irradiance ... amount of data The problem that we have to consider next is to estimate these model parameters more accurately It is obvious that the succession of phytoplankton is strongly affected by the zooplankton ... slow As a result, the grazing rate of zooplankton became a dominant factor to determine an apparent growth rate of phytoplankton That is why we can observe the impact of zooplankton community on...
- 8
- 524
- 0
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx
... that the actual path the user follows in the unconstrained area is consistent with the wall situation of the constraint area Therefore, particles will be eliminated due to the wall restrictions ... of this study is the transition model based on the 3D map database that is used within the PF Step displacement refers to calculation of one human step based on the inertial measurements and ... using the distance from the waypoint to the contour line When the gas is reaching a wall, the contour ends at the wall and the distance is equal to the distance to the wall Figure shows the polar...
- 14
- 488
- 0
Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf
... domain In the second one, the authors embed the mark in the spatial domain The main advantage of the second approach is that it is able to embed more than 250 bits and to withstand stirmark attack ... images to detect the mark and the H264 IBP20 model 32 images Finally, the worst result was obtained with the rotation attack that resulted in a detection at the 82nd frame We can also remark that ... they can embed two different watermarks depending on the motion activity, and then adapt the watermark to the content The temporal axis is performed here for discriminating the content and not to...
- 14
- 580
- 0
Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt
... what they said at each dialogue turn On the other hand, context elements contain all the additional information (explanations and descriptions) appearing in the scripts The extracted dialogues are ... actual values The final action taken by IRIS is related to the style/manner adaptation module For this action to take place the user has to include one of three possible adaptations commands at the ... html files Three basic elements are extracted from the scripts: speakers, utterances and context The speaker and utterance elements contain information about the characters who speak and what...
- 6
- 498
- 0
Báo cáo hóa học: " Research Article A Stereo Crosstalk Cancellation System Based on the Common-Acoustical Pole/Zero Model" docx
... the computation cost greatly The paper is organized as follows Conventional crosstalk cancellation methods are introduced in Section Then the proposed crosstalk cancellation method based on the ... of the crosstalk cancellation algorithm is crucial for practical applications To reduce the computational cost, this paper presents a novel crosstalk cancellation system based on common-acoustical ... Since the CAPZ model has advantages in storage and computation, the proposed method is more efficient than conventional ones Simulation results demonstrate that the proposed method can reduce the...
- 11
- 267
- 0
Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx
... selection, that can be obtained on the phenotypic scale in the offspring generation (compared to a situation with no selection) is equal to the expected response that can be obtained on the additive ... given that the parents of the next generation are selected, and the selected parents are mated at random, minus, the expected additive genetic value obtained without selection (and under the assumption ... of the additive genetic and the phenotypic scale) note that we have chosen a random mating strategy among selected parents as well as a random mating strategy when there is no selection Another...
- 27
- 254
- 0
Human capital accumulation by low skilled workers with borrowing constraints a welfare analysis based on the lucas rural urban migration model
... ratio of industrial and non-agricultural employment to urbanization, is used to measure the relation between industrialization and urbanization instead of the traditional standard value Generally, ... rural-urban migration dynamic model linked urbanization and growth The essential assumption of this model was that rural land had not any contribution for human capital accumulation This paper ... 90.2% in the total rural-urban migration, and the agricultural migrants with 94.8 percent of whole rural-urban migration are the non-hukou migrants On the other hand, the majority of the formal hukou...
- 128
- 292
- 0
A verification study based on the CTP model
... the lexical state declaration: %state STRING declares a lexical state STRING that can be used in the ‘lexical rules’ part of the specification A state declaration is a line starting with %state ... computational path • AG (EFx) : From any reachable state, there must exist a path starting from that state that reaches a state where x is asserted In other words, it must always be possible to ... proposition (AP) and a labeling function L that labels each state with a set of atomic propositions that are true in that state i.e ‘p is true at state s if p ∈ L(s) ’ The semantics of the CTL operators...
- 75
- 220
- 0
2013 a robust multiple watermarking scheme based on the DWT x
... apply sional DWT the IDWT to is applied to the LL sub-band The detail images get back to the spatial domain and obtain the w are called the atermarked vertical (LH), the horizontal (HL) and the ... Qualitative evaluation of the watermark presen ce can be done by comparing the two extracted watermarks with the original one Quantitativeevaluation is performed by calculating the similarity ... extracted watermarks are, afterwards, compared t o the original watermark to check the watermark presence in t he attacked image For objective examination, they calculate t he similarity ratio...
- 12
- 344
- 0
2013 a robust multiple watermarking scheme based on the DWT
... four extracted watermarks are, afterwards, compared to the original watermark to check the watermark presence in the attacked image For objective examination, they calculate the similarity ratio ... comparing the two extracted watermarks with the original one Quantitative evaluation is performed by calculating the similarity ratio (SR) between each extracted watermark and the original one The ... sub-bands They apply the IDWT to get back to the spatial domain and obtain the watermarked image The decoding process consists in applying the DWT and extracting the four embedded watermark copies The...
- 6
- 428
- 0
Reliability analysis of a power system based on the multi state system theory
... by the two methods VI with the traditional system reliability theory The results show that: CONCLUSIONS The multi-state system theory is introduced to analyze the reliability of the power system ... 6000} The results show that when the required capacity of the power system is 22.8 Ah, the result gained by the multi-state system theory is larger than the result gained by the traditional system ... the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity...
- 4
- 407
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... likewise it must be admitted that at the time the race was rowed, and probably before, B was not fit to engage in a contest which it has been said taxes to the utmost extent all the strength of the ... them that among sailors the disorders of the chest occasion about 28 per cent, of the general death-rate ; while the Reports on the health of the army clearly testify that in spite of the sanitary ... confessedly due to the fact that the men rowed when they were not in a fit state of health; in others, to the rowers being by nature constitutionally delicate; and in others again, to their having thoroughly...
- 419
- 541
- 0
Báo cáo " MODEL OF CONDUCTIVITY FOR PEROVSKITES BASED ON THE SCALING PROPERTY OF GRAIN BOUNDARY " ppt
... system but it lacks to bind to the apparent resistivity by its nature At this stage, their incorporation into the relation (7) was purely a model To confirm this model, one needs to arrange the Model ... these temperatures correspond to the Neel temperature TN of the charge-ordering antiferromagnetic-to-paramagnetic phase transitions Table lists the power factor n, the constant ρ0 and ρ1 that were ... They also developed linearly with the critical exponents n in the low temperature region; this fact argues for the fractal nature of n, but the confirmation needs further investigation In contrast...
- 8
- 324
- 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
... between the molecules and the SiNWs In addition, the THAP adsorbed on the clean Ag areas are not ordered according to the same structure as that observed upon adsorption on a clean Ag(1 0) surface ... contrast between the SiNWs and the Ag surface The molecular aggregates form discontinuous lines oriented along the ½110 direction of the Ag that corresponds to the direction of the SiNWs Furthermore, ... order to show that the LDOS of the SiNWs is distinct from that of the Ag(1 0) nearby Data carried out of both the SiNWs and the ONWs present significant changes First, the current measured on the ONWs...
- 5
- 465
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC ... CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) AGGCGgtgag/tccagTTGAA GACCGgtaag/tccagCTGCT GTGCGgtgag/tgtagGAGAC (110) AGGCGgtgag/tttagTTGAG GACCGgtaag/tccagCTGCT CTGCGgtgag/tgcagGAAAA...
- 10
- 451
- 0
Báo cáo khoa học: "A Hierarchical Bayesian Language Model based on Pitman-Yor Processes" docx
... conjugate gradient descent in the cross-entropy on the validation set At the optimal values, we folded the validation set into the training set to obtain the final n-gram probability estimates This ... Pitman-Yor language model based on these seating arrangements where the first probability on the right is the predictive probability under a particular setting of seating arrangements S and parameters ... the current states of all other variables It can be shown that the states of variables will converge to the required samples from the posterior distribution after a sufficient number of iterations...
- 8
- 386
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25