a bag is useful and the word

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

Ngày tải lên : 08/03/2014, 06:20
... items give an im- pression of the lexical and syntactic ambiguity of the respective grammars 4 The German and Japanese corpora and half of the English corpus consist of transliterations of ... grammars have between 20 and 120 unary and binary rule schemata. Since all rule schemata in our system bear a unique number, this filter can be realized as a three di- mensional boolean array. ... disjunctive normal form (DNF). Of course, the ratio of the number of rules and lexical entries in the original grammar and the DNFed grammar depends on the 'style' of the grammar...
  • 8
  • 340
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Ngày tải lên : 17/03/2014, 10:20
... dysfunction. ACKNOWLEDGEMENTS We thank Drs Carlos E. Argaran ˜ a and Mario Guido for critical reading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachner for technical assistance and Dr Stephen Anderson ... days. The antisera were usually collected 15 days after each injection and tested for affinity and specificity and stored at )20 °C. Mouse monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total ... Secretarı ´ adeCienciayTe ´ cnicadelaUniver- sidad Nacional de Co ´ rdoba y Agencia Co ´ rdoba Ciencia del Gobierno de la Provincia de Co ´ rdoba, Argentina. REFERENCES 1. Barra, H.S., Arce, C .A. ,...
  • 9
  • 518
  • 0
Đề tài " A Mass Transference Principle and the Duffin-Schaeffer conjecture for Hausdorff measures " pdf

Đề tài " A Mass Transference Principle and the Duffin-Schaeffer conjecture for Hausdorff measures " pdf

Ngày tải lên : 22/03/2014, 20:20
... BERESNEVICH AND SANJU VELANI 5.5. The measure of an arbitrary ball. Set r o := min{r(B):B ∈ K(2)}. Take an arbitrary ball A in R k with r (A) <r o . The aim of this section is to establish (13) for A; ... Lemma 5, it is clear that (P2) and (P3) are fulfilled for i = 1. By (14) and the fact that the balls in K f G,B are disjoint, we also have that (P1) is satisfied within this first sub-level. Clearly, ... H k (B). This can be established by first noting that the ratio of the radii of the balls B k i and B f i are uniformly bounded between positive constants and then adapting the proof of Lemma 6 in the...
  • 23
  • 304
  • 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Ngày tải lên : 23/03/2014, 10:20
... EcoRI-T 7 -ccccaaaaaaatttacaaaaaatc-BamHI A ă ARS-S EcoRI-T 7 -ccccaaaaaaattt-BamHI Poly (A) 50 EcoRI-T 7 -aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI Binding of IMP1 to PABP and PABP-mRNA G. P. Patel and J. Bag 5686 ... EcoRI-T 7 -tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI A ă ARS-L EcoRI-T 7 -aaaaaatccaaaaaaaatct-BamHI A ă ARS-C EcoRI-T 7 -tctaaaaaaatcttttaaaaaacccc-BamHI A ă ARS-R EcoRI-T 7 -ccccaaaaaaatttacaaaaaatc-BamHI A ă ARS-S ... were Table 1. Primers used to create various ARS constructs. Primer Sense sequence ARS EcoRI-T 7 -aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI A ă ARS-4 EcoRI-T 7 -tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI A ă ARS-L...
  • 13
  • 466
  • 0
Báo cáo khoa học: "A Theory of Parallelism and the Case of VP Ellipsis" pot

Báo cáo khoa học: "A Theory of Parallelism and the Case of VP Ellipsis" pot

Ngày tải lên : 24/03/2014, 03:21
... parallelism between clauses 1 and 2, and cases *c and *d from the parallelism between clauses 1 and 3. However, because parallelism is also required be- tween clauses 2 and 3, we cannot choose these ... in a natural and straightforward fash- ion. Furthermore, the generality of the approach makes it directly applicable to a variety of other types of ellipsis and reference in natural language. ... Phenomenon Example 'Do It' Anaphora 'Do So' Anaphora Stripping Comparative Deletion 'Same As' Reference 'Me Too' Phenomena 'one' Anaphora Lazy...
  • 8
  • 361
  • 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Ngày tải lên : 30/03/2014, 04:20
... a- crystallin Temperature dependence and the nature of the aggregating species Agata Rekas 1,2 , Lucy Jankova 3 , David C. Thorn 4 , Roberto Cappai 5,6 and John A. Carver 4 1 Department of Chemistry, ... Australia 2 Institute for Environmental Research, Australian Nuclear Science and Technology Organization, Menai, Australia 3 ATA Scientific Pty Ltd ANSTO Woods Centre, Lucas Heights, Australia 4 ... a- synuclein aggregation by aB-crystallin DPI was used to monitor real-time a- synuclein aggrega- tion and the effect of aB-crystallin on this, particularly at the very early stages of this process. In a...
  • 16
  • 577
  • 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Ngày tải lên : 31/03/2014, 07:20
... des- pentapeptide analogue and comparison with crystal structure. Biochemistry 29, 10545–10555. 21. Nagata, K., Hatanaka, H., Kohda, D., Kataoka, H., Nagasawa, H.,Isogai ,A. ,Ishizaki,H.,Suzuki ,A. &Inagaki,F.(1995)Three- dimensional ... legumes Toshimasa Yamazaki 1 , Motoko Takaoka 2,3 , Etsuko Katoh 1 , Kazuki Hanada 2 , Masashi Sakita 2 , Kyoko Sakata 2 , Yuji Nishiuchi 4 and Hisashi Hirano 2 1 National Institute of Agrobiological Sciences, ... DNAs as templates and the synthetic primers legF1 (5Â-AGC AGCAGATTGTAATGGTG-3Â)andlegR1(5Â-CAGC ACTTCAGAATCAGAGTC-3Â). PCR products were cloned on pT7Blue T-vector (Novagen, Darmstadt) and their...
  • 8
  • 386
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... mutants) and per-manganese metal basis (manganese superoxide dismutase mutants). Table 2. Metal contents of mutant superoxide dismutases. Metal con- tent was measured by atomic absorbance and is ... residues. Further analysis of these and other mutant SODs is currently underway. ACKNOWLEDGEMENTS We are indebted to G. Peplow, F. Yamakura and T. Matsumoto for the analyses of iron and manganese in ... program CE [35] while mutational analyses were carried out using the CARA and ENCAD algorithms included in the GENEMINE program. Bacterial strains and vectors The mutagenesis and expression phagemid,...
  • 12
  • 740
  • 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Ngày tải lên : 06/03/2014, 09:22
... shown). However, taken together, these data support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains ... complexes are large multisubunit assemblies containing either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of approximately 10 Brg ⁄ Brm-associated factors (BAF). Among the later, ... 5ÂTCTTCGAGTG CAAGTCCAAA and 5ÂAAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar- boxylase mRNA levels, detected by RT-PCR with specic primers 5ÂGTCAGCCGCATCTTCTTTTG and 5ÂGCAGA GATGATGACCCTTT. Cell...
  • 12
  • 432
  • 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Ngày tải lên : 16/03/2014, 04:20
... used the construct pGEMT5ÂHumanCPT1B as a template in a PCR reaction with primers DH673 (5Â-AGCTGAATTC ATGGCGGAAGCTCACCAG-3Â) and DH803 (5Â-TCCA CCCATGGTAGCAGAGAAGCAGCTT AAGGGTTTGG CGGA-3Â). The ... human D17E, and analyzed the affinity for the substrate carnitine and malonyl-CoA sensitivity. These mutants were active (Table 2) and expressed in P. pastoris at the same level as wild-type human ... Site-Directed Mutagenesis Kit (Strata- gene). The primers used were DH801 (5Â-TTCTTCCGCCA AACC CTTAAGCTGCTGCTTTCCTAC-3Â) and DH802 (5Â-GTAGGAAAGCAGCAG CTTAAGGGTTTGGCGGA AGAA-3Â). Using this procedure,...
  • 9
  • 550
  • 0

Xem thêm