a at t 0 the circuit has reached steady state so that the equivalent circuit is shown in figure a
A contrastive Analysis of the Metaphor “Anger is Heat” in English and the Possible Equivalent Expressions in Vietnamese
... (at least the everyday English) language is conduit metaphor This conceptual metaphor states that ideas are manipulatable things that can be packed into words and language, and then transferred ... that this study is limited in many ways The data, especially in Vietnamese, were mainly collected from the Internet, so they may lack reality Therefore, all the remarks and comments on the study ... concrete than the target domain (Esenova: 200 0) As a result, to know a conceptual metaphor is to know the set of mappings that applies to a given source-target pairing 1.2.2.3 The structure of a conceptual...
- 12
- 843
- 9
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... Bridging the schism between physical and mental health formalized by the state s Medicaid waiver by requiring that state laws and state Medicaid contracts mandate communication and information-sharing ... detrimental development (Powell, Fixsen, and Dunlap, 200 3) The data also suggest that solutions to maternal and child health care must address the broader social issues that sustain these disparities ... interviewers after receiving formal training in the conduct of qualitative interviews The members of the learning collaborative and their organizational affiliations are listed in Appendix A The full learning...
- 79
- 343
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... the interview necessitated a small sample size to ensure that the quantity of data remained at manageable levels A point of data saturation was quickly reached – the point at which the researcher ... management was facilitated by the use of the MaxQDA qualitative data analysis package Results Of the 21 nurses interviewed, only four stated that they intended to remain in Ireland on a long-term ... live in Because it's hard to start and start and start again, you know' (Clara, Philippines, 30 s) Frustration stemmed from the fact that there was still a nursing shortage in Ireland, but that the...
- 12
- 495
- 0
Báo cáo khoa học: "A COMFUTATIONAL THEORY OF THE FUNCTION OF CLUE WORDS IN ARGUMENT UNDERSTANDING" potx
... additional problem, due to the fact that evidence is treated as a transitive relation Sons are to be attached to their immediate father; so, it may be necessary to relocate sons that have been attached ... this algorithm indicates that it works in linear time (i.e it takes a linear factor of the number of nodes of the tree to locate all propositions in tile representation) Here, the representation ... relation of the prior proposition is set out b.elow according the the interpretation rule for the category that "as a result" belongs to in the taxonomy The particular evidence connection advocated...
- 8
- 384
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... characteristics, it can be remarked that the numerical model can simulate wave transformation in the nearshore region with an acceptable accuracy. 00 6 00 5 k /c 00 4 00 3 00 2 00 1 ... equal to zero), the average water level at the cell side is assumed equal to the water level at the wetted cell. Based on the bed elevation at its two ends and the average ... non‐dimensional TKE and its advective transport is less satisfactory than that of the water level or flow velocity. It must be noted that the computation of TKE employs a depth‐...
- 11
- 460
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... coagulation factor II NM _00 0133 coagulation factor IX NM _00 01 30 coagulation factor V NM _00 0131 coagulation factor VII, transcript variant NM _00 0 504 coagulation factor X NM _00 0128 coagulation factor ... 1 .00 ATP-binding cassette, sub-family transcript variant ATP-binding cassette, sub-family ATP-binding cassette, sub-family transcript variant ATP-binding cassette, sub-family ATP-binding cassette, ... 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 1 .00 0. 16 8.98 116.43 1 .00 CYP4 50 AF355 802 NM _03 1226 NM _00 0762 NM _00 07 70 NM _00 0775 NM _00 0 500 NM _05 7157 NM _01 74 60 NM _00 0765 NM _01 6593 NM _00 0779...
- 14
- 597
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... just thinking 0. 081 0. 092 0. 214 0. 073 0. 201 0. 200 -0. 006 0. 012 0. 185 -0. 087 0. 192 0. 127 0. 026 -0. 095 0. 0 70 0.635 0. 825 0. 782 0. 753 0. 676 -0. 083 0. 009 0. 049 0. 124 0. 128 .whether child's medical treatments ... -0. 1 20 0 .05 1 0. 121 0. 005 0. 8 50 0.886 0. 854 0. 767 0. 869 0. 013 -0. 0 60 -0. 108 0. 036 -0. 002 0. 041 0. 205 0. 285 -0. 0 60 -0. 162 0. 179 0. 018 -0. 1 30 0 .03 9 0. 102 Communication .feel others don 't understand ... stress or tension between family members 0. 848 0. 911 0. 8 90 0. 904 0. 9 30 -0. 031 -0. 027 0. 042 0. 103 -0. 188 -0. 044 0. 019 -0. 045 -0. 048 -0. 109 0. 064 0. 065 0. 103 0. 077 0. 138 0. 099 -0. 059 -0. 013 -0. 016...
- 11
- 552
- 0
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx
... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate ... reaction product of laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can ... deposit can be seen (Figs 1-4) in the latex canals and some other cells, such as sheath cells, epithelial cells and some parenchymatous cells The brown deposit in the sections indicates that the...
- 4
- 355
- 0
Báo cáo y học: " Does psychopathology at admission predict the length of inpatient stay in psychiatry? Implications for financing psychiatric services" ppsx
... this does not indicate that those factors might be an appropriate basis for psychiatric cost estimates Further research is needed to find either variables that better predict the LOS of inpatient ... characteristics of the inpatient episodes finally included in statistical analyses are shown in tables and The median age was 43 years 55% of the patients were males A comparison of the final ... Methods Catchment area and central psychiatric register Up to the year 200 9, the catchment area of the Psychiatric University Hospital Zurich included approximately 3 50, 000 inhabitants (today about...
- 10
- 515
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... with full metal jacket bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within ... diameters, primarily owing to differences in the depths to which they penetrate into the gelatin block These can be attributed to the fragmentation behavior of the soft point bullets and the associated ... inertia This might explain the fact that the suction effect of the negative pressure wave within the temporary cavity also influences the final position of the barium titanate particles This corresponds...
- 5
- 573
- 0
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx
... reference to a relative standard that shifts over time [8] The fact that active/ adaptive coping in this study is not associated with better self-reported functioning does not exclude that a reference ... research, adaptation is seen as the major mechanism of a positive reference shift, which refers to the idea that patients not rate their health in reference to an absolute standard but in reference to ... shift towards under-reporting takes place It could be that a positive reference shift through adaptation is present but cannot be picked up by the instruments used in the study, or that adaptation...
- 3
- 256
- 0
Báo cáo khoa học: "A systematic evaluation of the quality of meta-analyses in the critical care literature" pot
... included, although it is unlikely that they are systematically different It is also important to note that while the OQAQ is the instrument most widely used to grade the quality of meta-analyses and ... was in a critical care journal or a journal that primarily dealt with another area of medical practice Analysis The primary analysis of the data was descriptive The proportion of reports that ... with regards to the quality of reports of RCTs following the publication of the Consolidated Standards of Reporting Trials (CONSORT) statement [24] It is also possible that increased attention...
- 8
- 287
- 0
Báo cáo khoa học: "A comparative study of the complications of surgical tracheostomy in morbidly obese critically ill patients" pps
... mass index (BMI) of greater than or equal to 40 kg/m2 Statistical analysis Parametric interval data were analyzed using a two-tailed Student's t test These data are reported as mean ± standard ... deviation Nonparametric data were examined using a MannWhitney U test or Kruskal-Wallis test as appropriate Nominal data were analyzed by χ2 analysis with Yates continuity correc- Table Definitions ... patients is emphasized by the fact that this event is associated with 30% mortality in this series Morbidly obese patients with short, thick necks usually have too much soft tissue between the...
- 6
- 485
- 0
Báo cáo y học: "A mathematical model for the adenylosuccinate synthetase reaction involved in purine biosynthesis" pot
... model and the experimental data was attained at KmMg = 0. 01 mM Overall, this modification is much less consistent with the experimental data than the original model (calculations not shown) The ... hypothesis states that ASP binds to the enzyme to form an AdSS·ASP complex, after which magnesium binds to aspartate in that complex To describe this hypothesis, another modification of the original ... who examined the effect of SUCC in detail [7], proposed that SUCC is competitive to ASP Our calculations indicate that this assumption is consistent with the kinetic data The model output and experimental...
- 11
- 311
- 0
Báo cáo y học: "A systematic review of the impact of sedation practice in the ICU on resource use, costs and patient safety" pptx
... data - either they did not contain data on the outcomes abstracted in this review or they did not 2967 citations from literature databases 2124 citations after eliminating duplicates 1964 citations ... management approach is clinically important The available data also support an association between improvements in sedation practice and improved patient safety Protocol-directed sedation tended to ... available for other safety outcomes Increased rates of accidental extubation were not reported in most studies, and in the RCT that did report an increase in the intervention group the data suggested...
- 11
- 258
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 108 4 CTT1F AAAGAGTTCCGGAGCGTGTA ... PAC2R AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA 1164 HSP12R GCTTGGTCTGCCAAAGATTC 1244 PNC1F TTGTGGTCACCAGAGATTGG ... before being photographed NAD+ measurements Table Primers for Q RT-PCR Primer Alias Sequence 108 2 ACT1F GCCTTCTACGTTTCCATCCA 108 3 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368...
- 17
- 432
- 0
A study on improving the quality of human resource in Quang Ninh province customs department
... and appropriate reward Chart 3.19 Fair treatment for staffs 90 Person 80 70 • Totally disagree 60 • Disagree 50 i- Parth agree 40 r • Agree 30 • Totallv aaree 20 10 Treatment for statTs 34 Chart ... with capacity Part 3.17 Transparency of staff planning and appointment 90 Person 80 ^ 70 Totally disagree 60 Disagree 50 Parth agree 40 Agree 30 Totallv aaree 20 10 Plaiuuna and Appointment 33 ... sector This is a great drawback in recruitment of Quang Ninh Customs Department All candidates the exam with the same content applied in the whole customs sector Subjects in the exam are State Administration,...
- 107
- 683
- 0
Developing the competitive strategy for thien hoa’s supermarket system on a retail market of the electronic and electrical appliances in Hochiminh city
... positioning matrix and evaluation activities - SPACE Matrix: The strategic positioning matrix and evaluation activities is a strategic planning tool during the combination of strategic analysis framework ... high-level management The transition from stage of setting the strategy into stage to implement the strategy should have the participation of the functional administrators and related parts as much as ... now, there is micro, not macro-taking at the national level Also appearing term sustainable competitive advantage means that enterprises must continuously provide the market a special value that...
- 110
- 572
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25