a amp 946 concentration in cns derived cell lines through the inhibition of intracellular degradation
Báo cáo khoa học: 3 Cdt1 and geminin are down-regulated upon cell cycle exit and are over-expressed in cancer-derived cell lines potx
Ngày tải lên :
07/03/2014, 16:20
... geminin gene were generated by random priming using the complete open reading frame of the human geminin cDNA A probe directed against the actin mRNA served as a loading control A blot containing ... percentage of HeLa cells actively cycling In addition to that however, the staining observed in individual HeLa cells was higher than the staining observed in individual HFF cells (Fig 7A) Quantitation ... known as the intervillus epithelium Cdt1 mRNA is mainly localized at the bases of the developing intestinal villi (the intervillus epithelium), where the proliferating cells of the intestinal epithelium...
- 11
- 485
- 0
Báo cáo hóa học: " Inhibition of histone deacetylation in 293GPG packaging cell line improves the production of self-inactivating MLV-derived retroviral vectors" pdf
Ngày tải lên :
20/06/2014, 01:20
... Nepean, ONT)] A5 49, a human lung carcinoma cell line, was obtained from the American Type Culture Collection (ATCC, Manassas, VA) and was maintained in DMEM supplemented with 10%heat-inactivated ... suggested a negative interference of the tyrosinase enhancer on the viral enhancer when the latter was retained in the 3'LTR It has been also reported that the muscle creatinine kinase enhancer had a ... Health Research Grant MOP-15017 and by a National Cancer Institute of Canada Terry Fox New Frontiers Grant Jacques Galipeau is a recipient of a Canadian Institutes for Health Research Clinician-...
- 12
- 436
- 0
ERK1 AND ERK2 IN HEMATOPOIESIS, MAST CELL FUNCTION, AND THE MANAGEMENT OF NF1-ASSOCIATED LEUKEMIA AND TUMORS
Ngày tải lên :
24/08/2014, 12:53
... at least in part, as a p21ras (Ras) guanosine tri-phosphatase (GTP) activating protein (GAP) (68-72) Neurofibromin and other Ras-GAPs logarithmically accelerate the intrinsic hydrolysis of Ras-GTP ... gating was typically determined using fluorescence minus-one controls Gates were set on a single sample in a blinded fashion and then automatically applied to all samples 28 Quantitative data ... resuspended in 4',6-diamidino-2-phenylindole (DAPI, Invitrogen) containing PBS, allowing efficient visualization of low cell numbers The ability of the FACSAria to accurately perform single -cell plating...
- 246
- 203
- 0
Báo cáo khoa học: " Pichinde virus induces microvascular endothelial cell permeability through the production of nitric oxide" pot
Ngày tải lên :
12/08/2014, 04:20
... induction of vascular leak was also determined Inhibitors of vascular leak were evaluated for their ability to alter virus-induced leak Finally, a caspase assay was used to determine if PIC-infected ... detection of activated caspases indicates PIC induces an increase in activated caspases-3 and -7 at MOIs of and 10 (Fig 6) Addition of L-NAME at concentrations that block PIC-induced leak did not ... KT, Binion DG: Cyclosporine A enhances leukocyte binding by human intestinal microvascular endothelial cells through inhibition of p38 MAPK and iNOS Paradoxical proinflammatory effect on the microvascular...
- 6
- 228
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
Ngày tải lên :
19/02/2014, 06:20
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... et al naya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... and then subjected to northern blot analysis Each lane contains 15 lg of total RNA The bottom panel shows the expression of b-actin mRNA as an internal control (B) Western blot analysis The indicated...
- 12
- 621
- 0
Báo cáo hóa học: " A pilot clinical trial testing mutant von HippelLindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma" doc
Ngày tải lên :
18/06/2014, 16:20
... thank Drs Raed N Samara and Maher Abdalla for their contribution toward the study by helping in the manuscript drafting Drs Samara and Abdalla are postdoctoral fellows at the National Cancer Institute ... result for the patient was defined as a total number of experimental spots in the postvaccination sample of more than twofold above the total spots in the prevaccination sample Regulatory T cells ... potential binding affinity of the amino acid motif spanning the mutation to the patient’s HLA (Table and 2) Peptides were designed based on the predicted binding affinity using the BIMAS program...
- 9
- 477
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Ngày tải lên :
18/06/2014, 22:20
... The cell line response data was compared to the mutation patterns in the cell lines, gene expression patterns and the karyotypes of the cell lines High chromosome number in the cell lines was associated ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... subset of karyotype data available, we found that the average percentage of polyploid subpopulations was substantially higher for the resistant cell lines compared to sensitive cell lines in the panel...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
Ngày tải lên :
20/06/2014, 04:20
... The cell line response data was compared to the mutation patterns in the cell lines, gene expression patterns and the karyotypes of the cell lines High chromosome number in the cell lines was associated ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... subset of karyotype data available, we found that the average percentage of polyploid subpopulations was substantially higher for the resistant cell lines compared to sensitive cell lines in the panel...
- 10
- 665
- 0
báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx
Ngày tải lên :
10/08/2014, 22:20
... |||||||||||||||||||||||||| aggaaagatgatgctcagttttaaaccccctttttaattttggacacggtct |||||||||||||||||||||| agctctgtttttttttttgttttgttttgttttttaattttggacacggtct NUP214 intr 17/18 ttctggtataaagctctcaaatgtgaccatgtgaatctgggtgggataatgg ... ttctggtataaagctctcaaatgtgaccatgtgaatctgggtgggataatgg |||||||||||||||||||||||||| ttctggtataaagctctcaaatgtgatttgtctccattacagttaattttat |||||||||||||||||||||||||| aggtttagaattactttcagcaccgttttgtctccattacagttaattttat Figure MEGAL Deletion ... with Ab raised against the N-terminal region of SET and against the C-terminal region of NUP214 Cell lines LOUCY and MEGAL expressed the 140 kDa SET-NUP214 fusion protein and a 240 kDa protein marked...
- 5
- 199
- 0
Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions
Ngày tải lên :
10/09/2015, 09:29
... HRS cells Recombinant neutralizing antibody of CCL5 can inhibit the basal proliferation of these HL -derived cell lines (Aldinucci et al., 2008) B cells of various maturation stages are part of the ... and IL-13 Cytokines produced by THelper2 cells can activate mast cells and eosinophils, thereby eradicating helminths and other extracellular parasites (O'Garra and Arai, 2000) In addition, these ... gain of JAK2 and suppressor of cytokine signaling (SOCS1), which is a negative regulator of JAK-STAT signaling in HRS cells Hence, JAK-STAT signaling is often somatically mutated and inactivated...
- 204
- 400
- 0
Effects and mechanisms of a concentrated goyasaponin fraction in 3t3 l1 cell line
Ngày tải lên :
05/10/2015, 19:06
... function as PPARγ agonists The main actions of TZDs include increasing systematic insulin sensitivity, increasing peripheral glucose uptake, reducing plasma fatty acid concentration and enhancing adiponectin ... complications including heart disease, retinal damage, renal failure and stroke [9], it was ranked sixth as the leading cause of death in United States in 2004 [10] In normal subjects, the plasma ... relative expression of protein was quantified using the software GelPro 32 and calculated according to the reference bands of Beta Actin The data are expressed as a percentage, relative to PPARγ...
- 89
- 271
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
Ngày tải lên :
19/02/2014, 16:20
... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266 ... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
Ngày tải lên :
20/02/2014, 23:20
... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... cloned the cDNA of each A single amino acid (aa) substitution was confirmed to affect the thermal stabilities of vertebrate DNases I and, furthermore, one of the postulated mechanisms whereby thermal...
- 8
- 500
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... production, indicating that TS activated a LPS-stimulated signal pathway (Fig 4) PKC is a key kinase in the LPSstimulated signal pathway [30,31] The findings that PKC inhibitors, not PKA inhibitors, inhibited ... RRR -a- Tocopherol (a- T) was kindly provided by Eisai Co (Tokyo, Japan) Other reagents were of the highest grade commercially available Data were expressed as the mean ± standard deviation of at ... cells, and then the cell suspension was sonicated in a bath-type sonicator for 5min The amount of protein of the solubilized cells was determined with a bicinchoninic acid protein assay kit (PIERCE,...
- 6
- 494
- 0
Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx
Ngày tải lên :
07/03/2014, 15:20
... manifest as a general reduction in cell proliferation and the appearance of senescence characteristics The activation of p21waf1 appeared to play an important role in mediating this effect, as ... may have been the result of a general and simultaneous blockade of all three phases of the cell cycle Cell proliferation is reduced The reduction in cell number may have been a result of an inhibition ... reduction in Fig The effect of CDO in HCT116 and GEO cell lines on day The activity of CDO in the sensitive cell lines was fitted a standard Emax model Representative DNA histograms following culture...
- 9
- 331
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
Ngày tải lên :
16/03/2014, 01:20
... pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC ... HSP70 in the inhibition of the release of Smac and apoptosis GAPDH Ratio of HSP70 to GAPDH 14 # 12 # 10 * The role of the ATP-binding domain of HSP70 in the prevention of the release of Smac and apoptosis ... compilation ª 2009 FEBS B Jiang et al The ATP-binding domain of HSP70 is important for the interaction of HSP70 with apoptosis signalregulating kinase (ASK1) and the inhibition of ASK1-induced apoptosis...
- 10
- 726
- 0
Improving Maternal, Newborn, Child Health, and Family Planning Programs through the Application of Collaborative Improvement in Developing Countries: A Practical Orientation Guide pptx
Ngày tải lên :
23/03/2014, 06:20
... Outreach vaccination Family Planning services Integrated community case management Infant and Child Care: of child Illness (malaria, pneumonia, and Vaccination diarrhea) Integrated management ... Improving MNCH and FP programs through collaborative improvement · Essential Obstetric Care: The use of partograph increased substantially in Afghanistan and Guatemala and the application of active ... active management of third stage of labor (AMTSL) in several countries including Niger, Mali, Afghanistan, and Ecuador increased substantially Essential Newborn Care: In Uganda, the ability of the...
- 34
- 542
- 0
Báo cáo khoa học: The inhibition of Ras farnesylation leads to an increase in p27Kip1 and G1 cell cycle arrest pdf
Ngày tải lên :
31/03/2014, 01:20
... both as a substrate and as an inhibitor of Cdk2 In summary, HR12 inhibits the degradation of the p27Kip1 protein in Rat1/ras cells, possibly via the Ras-to-RhoA pathway Is the increase in p27Kip1 ... HR12 on anchorageindependent growth of Rat1/ras cells, using the assay for colony growth in soft agar HR12 treatment inhibited the growth of Rat1/ras cells in soft agar in a dose-dependent manner, ... repression) of PKB This activation of PKB was probably a secondary event that arose as a consequence of the assembly and activation of focal adhesions and cell cell contacts [6] The Raf/Mek/Erk pathway...
- 14
- 474
- 0
báo cáo hóa học: " Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines" docx
Ngày tải lên :
20/06/2014, 00:20
... Mengata DE: Natural protoberine alkaloids from Enantia chlorantha, palmatine, columbamine and jatrorrhizine for thioacetamide-traumatiezd rat liver Acta Anatomica (Basel) 1988, 131:166-170 44 Srinivasan ... macerates corresponding to 1/10 of dried plants in a water-alcohool solution of 45 to 55% They are afterwards diluted in 70% alcohol with Taraxacum officinalis macerate at 10-4, Arctium lappa ... of the manuscript, participated in the design of the work and was responsible for the coordination All authors read and approved the final manuscript Competing interests The authors declare that...
- 13
- 184
- 0
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
Ngày tải lên :
20/06/2014, 01:20
... CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT TATCAAATTCAAGTGAAT TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCT GAACTGTAGCTGATGTTAT ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGA CTAACCCTGTTCCCAGAGCC ... TTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAG CCCCTGAACTTCCACGCCA GCAAGAAGTTACGACACGTACACAACGACAGAACAACAGAGAAGACCCCG AAGACCACTAGCACGACCGT CGAAGGAAAGTGGAGCTCTTCATCGCCACCTCCCAGAAGTTTATCCAGGAG ACAGAGCTGAGCCAGCGCA CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT ... TCATCCAGACTTAGCCAC GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA ACCTTGGCCATCTATGACCTGGCTACGCAGACTCTTAGGCATCAGTGTCAG CACCAGTCGGGCATCGTGC TTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCC...
- 15
- 426
- 0