a a green economy in the context of sustainable development and poverty eradication and b the institutional framework for sustainable development

ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

Ngày tải lên : 15/03/2014, 16:20

... Bartelmus, FISD: A Framework forIndicators of Sustainable Development (New York, in press) 23 Albert Adriaanse, "In Search of Balance: A conceptual framework for sustainable development indicators," presented ... Sustainability Index But the indicators of each attribute appear to be assigned somewhat arbitrarily and the attributes themselves may overlap (Resilience and stability, for instance, are similar.) ... could also be combined with other health information to create an overall health index of use as an indicator of sustainable development IX APPROACHES TO SUSTAINABLE DEVELOPMENT INDICATORS This...

58
698
0

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 2

Ngày tải lên : 16/09/2015, 08:29

... summary of the mathematical theory of the AHP, as reference to Saaty and Vargas (1991) and Harker (1989) The matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 … An A1 ... parking areas) Quality of parking area development Parking areas are in multi-storey carpark surrounded with some landscaping, and dedicated walkways lead from parking areas to a building entrance ... preservation of the outward appearance of the buildings, safety of occupants of other flats, safety of the buildings, or for the preservation of the peaceable enjoyment by the other occupants of their...

75
365
0

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 3

Ngày tải lên : 16/09/2015, 08:29

... bases on the distance of available point that horizontal and downward views are available of the interior of bedroom and living areas of certain percentage of dwelling units of the building Interpreting ... performance, the building footprint area (Af) and the percentage of hard-paved area of the site (P) should be kept as low as possible, and the total net usable area of the building (Anet) should be ... performance in environmental performance can be shifted to that of land use efficiency in sustainable housing performance Before looking into how the Integrated Framework for Sustainable Housing...

131
400
0

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 4

Ngày tải lên : 16/09/2015, 08:29

... assessment at individual building scale The preliminary structure, and the above two standpoints of ArchSAM – relative assessment and scale of built environment for sustainable development, has laid ... Systematic approaches to sustainable housing performance and preliminary development of ArchSAM The systematic approach to each of the five sustainable housing performance issues (Part III) is the ... International Conference on Sustainable Building Norway: International Council for Research and Innovation in Building and Construction 368 Phillips, C (2003) Sustainable Place : a Place of Sustainable...

59
395
0

Environmental performance and sustainable architecture a critical review in the context of singapore public housing 1

Ngày tải lên : 16/09/2015, 08:29

... Conference in Canada The objective of GBC is not a commercial tool, but rather a research and testing tool acting as a generic framework for global practice and national adaptation In the words of Raymond ... socio-economics, and architectural design – all are relevant and have certain validities to sustainable architecture The scope of coverage of sustainable architecture must include all the above domains and ... design a mainstream in architectural design and discourse (Hagan, 2001) As a result of the analysis above and the contestation between the three domains, the approaches towards sustainable built...

113
271
0

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

Ngày tải lên : 27/12/2013, 20:26

... learning style preferences and needs, planning for an L2 task, gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and ... portion of their education, their information, their understanding of the world and of human affairs, their ideals, senses of values and their appreciation” Seeing the importance of listening in real-life ... that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and the listener took in and stored aural messages in much the same way as a taperecorder...

99
805
0

Focus - A simplicity manifesto in the Age of Distraction

Ngày tải lên : 05/01/2014, 15:25

... and making you want to the activity again, as soon as possible You get the positive reinforcement again, and again, and again, in a constant cycle of positive reinforcement, and soon you’re addicted ... time and mind for creating, and create better and more prodigiously than ever before Separate your day: a time for creating, and a time for consuming and communicating And never the twain shall ... addiction: by breaking the cycle of positive feedback, and by replacing the old habit with a new one And while beating addictions is really a subject to be tackled in another book, let’s briefly outline...

121
552
1

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Ngày tải lên : 15/02/2014, 13:20

... ulcerates, forming a lesion approximately mm in diameter Draining lesions resulting from vaccination should be kept clean and bandaged Scabs form and heal usually within months after vaccination BCG vaccination ... children ages 5–12 years, and, beginning in the early teenage years, increased sharply with age for both sexes and all races Cases of TB among children age accounted for 7% of all TB cases ... useful in determining a) the efficacy of BCG vaccine in HCWs or b) the effects on efficacy of the vaccine strain administered Vol 45 / No RR-4 MMWR and the vaccinee’s age at the time of vaccination...

27
1.3K
3

Tài liệu Research " A diserttation submitted in partial satisfacion of the requirments for the degree Doctor of Philosophy in economics " ppt

Ngày tải lên : 18/02/2014, 11:20

154
396
0

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization ﬁeld pptx

Ngày tải lên : 21/02/2014, 01:21

... et al (Eur J Biochem 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre ... forming tissue of the snail Biomphalaria glabrata (Say) Biol Bull 194, 231–240 Miyazawa, T & Blout, E.R (1961) The infrared spectra of polypeptides in various conformations – amide I and II bands ... Characterization and quantiﬁcation of chitosan extracted from nacre of the abalone Haliotis tuberculata and the oyster Pinctada maxima Mar Biotechnol 3, 36–44 Alzieu, C., Thibaud, Y., Heral, M & Boutier,...

10
731
0

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Ngày tải lên : 21/02/2014, 03:20

... respectively The data points have been fitted with arbitrary functions (B) An enlarged view of (A) , showing only the data obtained in the absence of Du (C) The ratio of the best-fitting functions and of the ... [35] and can be interpreted as being due to a lag phase in the onset of D~Hỵ l ể FEBS 2002 Fig Rates of ATP synthesis induced by acid-base transitions in the presence and in the absence of a diffusion ... view of Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was higher than twofold, especially in the low DpH range...

9
580
0

Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc

Ngày tải lên : 21/02/2014, 08:20

... was out of the bag." The Captain saw it at once and laughed heartily over the error he had fallen into in the latter part of his "first appearance" as captain, in drilling the company as infantry ... next afternoon, the Captain, standing by the gangway, directed the embarkation of about 20 men in the smaller of the two surf boats in which the company was to land Just as that boat was ready ... relieved the Captain at the gangway and superintended the embarkation of the men in that boat The Captain was lowered over the side of the vessel in a chair; and I, when all else was ready to pull off,...

48
504
0

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Ngày tải lên : 22/02/2014, 04:20

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... the basis of the model, the behavior of the G26 1A variant can be interpreted in terms of constraints introduced by the Ala side chain The presence of the additional Gly at position 261 possibly ... local ﬂexibility and an increased Ea value The validity of the above interpretation was further reinforced by the construction of the double mutant G26 1A/ Y26 9A The additional substitution of...

6
488
0

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Ngày tải lên : 07/03/2014, 12:20

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...

16
397
0

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Ngày tải lên : 08/03/2014, 09:20

... listed in Table Strains CE1514 and CE1515 were obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, ... resuspended in the latter medium at the original absorbance, followed by incubation at 37 °C for 30 For pulse-labeling, cells were incubated for 45 s with Tran35S-label followed by a chase period with an ... replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse primer (5¢-CGCGGA TCCTTTTTGCTGTCAGTATCAC-3¢), pNN7 and pNN8 as the...

8
546
0

Báo cáo "The linguitic Situation of a Hmong Community in the North - West of Vietnam " pdf

Ngày tải lên : 12/03/2014, 00:21

9
372
0

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Ngày tải lên : 15/03/2014, 03:20

... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... Ultimately, the ophthalmologist and internist should increase their awareness and understanding of TB and its possible ocular involvement because the disease is curable and blindness is preventable [7] ... study in 2002 [8] Biswas and Badrinath examined 2,010 eyes of pulmonary TB patients and found a 1.39% ocular involvement [9] Other studies include data about ocular TB as a fraction of uveitis cases...

4
517
0

Research " A dissertation submitted in partial satisfaction of the requirements fog the degree Doctor of Philosophy in Economics " ppt

Ngày tải lên : 16/03/2014, 03:20

86
337
0

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Ngày tải lên : 16/03/2014, 04:20

... initiation (A/ GCCATGA/G) A 1809 bp cDNA fragment containing a stop codon was isolated by RT-PCR A 1007 bp cDNA containing a poly (A) tail was obtained by 3¢ RACE By combining these cDNA fragments, fad49 ... vertical bars in the top part of the ﬁgure The size of each exon is indicated in the bottom panel the database revealed that the GT ⁄ AG rule was maintained in all cases (data not shown) The deduced ... and human fad49 cDNAs have been deposited in the GenBank database with accession numbers AB430861 and AB430862, respectively Acknowledgements We thank Asako Shimada and Aya Fujii for technical...

13
385
0

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the speciﬁcity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Ngày tải lên : 16/03/2014, 16:20

... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB for ... aminic part determines the position of the substrate within the S1¢-binding subsite O atoms of the main chain CO groups of LeuB387 and TrpB240, Od1 atom of AsnB241, and Oc atom of SerB386 and is ... values of PhAc-MCA and PhAc-bNA (Table 2) The determined lower Km value for the PhAc-MCA could be ascribed to a more favourable hydrogen bonding interaction between ArgB263 and the remote carbonyl...

8
438
0