... of Patient A and B was 42 and 58, respectively The scores indicate that the Patients need for maximal or moderate assistance for achieving an adequate performance of ADL As the common clinical ... using HMD may displaya greater accuracy and be able to assess the occurrence and grade of USN to a greater degree more than the common clinical test HMD can produce an artificially versatile environment ... Patient A and B were 15 and points, respectively The behavioral neglect of Patient A was categorized moderate and Patient B was categorized as a mild level According to the motion analysis of head...
... areas) and was analyzed using the correct rate for six areas 51 points were set as a cutoff value 3-2 Special test with HMD (Figure 2) (a) Experimental apparatus The main experimental apparatus ... computer-generated object appropriate to the HMD position are displayed Virtual reality (VR) has many advantages over other ADL rehabilitation techniques and offers the potential to develop a human performance ... Pisella L, Farne A, Li L, Boisson D, Perenin M-T: Prism adaptation to a rightward optical deviation rehabilitates left hemispatial neglect Nature 1998, 395:166-169 Majoros AE, Boyle E: Maintainability...
... Ungchusak K, Auewarakul P, Dowell SF, Kitphati R, Auwanit W, Puthavathana P, Uiprasertkul M, Boonnak K, Pittayawonganon C, Cox NJ, et al.: Probable person-to-person transmission of avian influenza A ... Guan Y, Wang J, Smith GJ, Xu KM, Duan L, Rahardjo AP, Puthavathana P, Buranathai C, Nguyen TD, et al.: Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia ... antibodies used in the neutralization assay was lowered from A B 120 % Control 100 80 60 40 20 N o VN Ab 04 H A H A H A H A H A H A H A H A H 10 A H 11 A H 12 A H 14 A H 16 A H 17 A VL 18 P VL P VL P...
... rectangular array with the clock hands in place – remember LWDISPLAY Thus when an xref is attached to a drawing, the drawing layout is automatically updated when the original xref drawing is altered ... NEFERSAYDY built by MACFARAMUS MACFARAMUS was last encountered building the palace for queen NEFERSAYDY Unfortunately this palace was to be built on a flat topped hill and you have to create the layout ... to access, and alter, all drawing data It may be that a drawing with an xref attached is complete and that no additional updating is required It is then necessay to ‘bind’ the xref to the drawing...
... on Machine A, which is where the application is actually displayed The authority and display are now set on Machine C You should be able to run an X application on Machine C, and its display will ... on a laptop and the X application (i.e., client) that you want to run is located on a remote system You can arrange to have the application output display on the laptop The following paragraphs ... that authorization for Machine C to connect to the display on Machine A is in place, the last task is to set the DISPLAY variable for the X client on CHAPTER 21 ■ A BRIEF TOUR OF THE X DISPLAY...
... which report to display You can set the ReportSource in a variety of ways You can set the ReportSource property to the file path and name of a report, or you can create what is called a strongly typed ... you want to assign within your project folder The bad part about assigning the report file directly is that when you move the application, the file path is not updated A better way to assign the ... that was created in the last HowTo Play with the toolbar buttons on the Viewer to see how they work When you maximize the form, you the Viewer expands as well That is because the Viewer is anchored...
... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage -display was suggested by a new method called alanine shotgun scanning, which analyzes...
... particularly true in the case of OA complexes of a- LA, considering that: (a) a- LA itself can display an inherent apoptotic activity [58,59]; (b) a- LA alone can interact with histones at the cellular ... 37021–37029 ˚ 53 Hakansson A, Svensson M, Mossberg AK, Sabharwal H, Linse S, Lazou I, Lonnerdal B & Svanborg C (2000) ¨ A folding variant of alpha-lactalbumin with bactericidal activity against Streptococcus ... shown that the fragments acquire an enhanced content of a- helical secondary structure upon binding OA The physical and aggregation state of OA at physiological pH was analyzed by fluorescence and...
... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT ... mutagenesis (Qiagen, Crawley, UK) Primers used were: KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG...
... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... is a high affinity ligand for GABARAP peptides presumably interacted with GABARAP with similar affinities This considerable sequence variability for GABARAP binding peptides suggests that GABARAP ... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt,...
... publish a PsEPR event on a “channel” Practically speaking, a channel is a name Channel names are hierarchical, to enable prefix matches that enable subscription to a family of related channels ... on a channel (recall that a channel is associated with each PlanetLab node) and saves the properties in an inmemory database The tuple-store service also listens on the channel for queries and ... central canonical store and synchronization will undoubtedly limit the future scalability of the system Additionally, having a single central authority for authentication may present organizational...
... one male, with ages ranging from 24–55 years Subject A was female, age 53 years Subject B was female, age 55 years Subject C was female, age 24 years Subject D was male, age 32 years We also carried ... 2-D cursor control paradigm Sequential screen shots of the 2-D cursor control paradigm (a) A game grid is displayed showing a cursor, target, and trap (b) All squares except those adjacent the cursor ... software system for EEG data acquisition and processing TAK also assisted with data collection, performed the data analysis, and drafted and revised the manuscript OB developed the Matlab-based...
... cG250 and low dose subcutaneous IL-2 in patients with advanced renal cell carcinoma Cancer Immun, 2007, 7: 13 14 Xu C, Lo A, Yammanuru A, Tallarico AS, Brady K, Murakami A, Barteneva N, Zhu Q, Marasco ... Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, Jiquan Zhao1, Chunhua ... potential for use in early diagnosis and targeted therapy of RCC Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China)...
... introduced and propagated This is an advantage not readily available in some other systems Moreover, cDNA clones of viral RNA are infectious, making it easy to produce viable recombinant viruses that ... the attachment of a large variety of substances including metals, organics, peptides, and nucleic acids in a regular geometric array Thus, one can think of these virus-like particles as self-assembling ... for Genetic Analysis of a Protein-RNA Interaction J Biol Chem 1990, 265:5684-5689 Peabody DS and Al-Bitar L: Isolation of Viral Coat Protein Mutants With Altered Assembly and Aggregation Properties...
... Topisirovic L: Molecular characterization of a novel bacteriocin and an unusually large aggregation factor of Lactobacillus paracasei subsp paracasei BGSJ2-8, a natural isolate from homemade cheese Curr ... (5'-CCGGAAACGTCACCAATGAA) and BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA) and was analyzed on a ABI3730 Genetic Analyzer (Applied Biosystems) at AWC ... EV, Tatusov RL: Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search...
... fever, headache, myalgia, nausea and vomiting, accompanied by joint pains, weakness, rash and thrombocytopenia The fever may last for to days, with a saddleback pattern, characterized by a drop ... 1996; Halstead et al., 2002) DHF is characterized by high fever, haemorrhagic manifestations and circulatory failure as a result of plasma leakage Increased vascular permeability may lead to shock ... motivate community participation (Knudsen et al., 1992) As a result, A aegypti rapidly re- colonised the Americas after the cessation of the A aegypti eradication program and dengue reappeared...
... damage (indicated by elevation in the levels of liver enzymes aspartate aminotransferase and alanine aminotransferase), circulatory failure, accompanied by thrombocytopenia and haemoconcentration ... deepest appreciation to all the members of Vasudevan Lab for their guidance, assistance and help In particular, I would like to thank Elfin Lim, Dr Ravikumar Rajamanonmani, Dr Danny Doan, and Dr Prasad ... mainly in Southeast and South Asian, Caribbean, as well as Central and South American regions Almost 100 million cases of dengue infection are reported each year, with an estimated 500000 cases...