8 a penalty imposed under this regulation is payable to the designated authority which imposes it
This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi
... practical teaching in comparison with the product approach, the process approach also came under attack from various genre theorists One of its limitations claimed is that it does not address the ... units and revision units As the book is theme-based, each unit is relevant to a specific theme and has the following consistent parts: A Reading, B Speaking, C Listening, D Writing and E Language ... 2007: 12) Another weakness of the approach arises from the fact that, in practical teaching, it is unable for teachers to teach all the genres to the students in the classroom In spite of the tension...
- 31
- 560
- 2
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... interactions to those described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase ... conformation (checked against the final coordinates) due to the poor quality of the maps, and refinement with refmac5 [29] stalled at R-factors of 26 and 30% This may be due to real disorder in the ... water molecule with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis in HsSTP is His62, which may act...
- 10
- 542
- 0
This Time is Different, Again? The United States Five Years after the Onset of Subprime potx
... responses that frankly, may take years of analysis to sort out Rather, our aim is to clear the air that somehow the United States is different The latest US financial crisis, yet again, proved it is not ... before the crisis or the crisis year For real per capita GDP we use the Total Economy Database, a multi-country database originated by Angus Maddison and now updated by the Conference Board: the ... recent annual observation is 2011 The US data is available from 187 0 onward For US unemployment the data is taken from the Historical Statistics of the Unites States, where the unemployment rate...
- 9
- 357
- 0
information in this document is subject to change without notice. the names of companies, products, people, characters,
... server Create additional data administrators to handle routine administration Assign access controls on the namespace and the administrative areas to protect the privacy of user data Avoid setting ... provide a set of containers to separate the metadirectory into manageable parts To create a name structure entirely based on manageability, create containers (administrative areas) that map to your ... Developing a Metadirectory 19 When a new employee is hired at NWTraders Corporation, the HR manager sends an e-mail message to the HR SQL database administrator, the e-mail administrator, and the network...
- 24
- 495
- 0
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx
... well as a single-cell suspension of bone marrow, were obtained The samples were treated with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and total RNA and DNA were isolated according to the manufacturer ... precipitated DNA was washed with 0.1 M sodium citrate followed by 75% ethanol The total extracted RNA and DNA were dissolved in nuclease-free water (Invitrogen) Total DNA of E coli was isolated ... manufacturer protocols Subsequently, RNA was extracted with chloroform and precipitated with isopropyl alcohol The DNA was isolated by ethanol precipitation of the interphase and phenol phase The...
- 10
- 243
- 0
Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis ppt
... protein (AtRMR1) was found to colocalize with a protein storage vacuole membrane marker and was predicted to be a receptor mediating targeting to the plant storage vacuole [10] This organelle is a multivesicular ... can abrogate E3 ligase activity Failure to catalyze polyubiquitination was also seen when assay mixtures were prepared that lacked any E2 enzyme (Fig S2C, lanes and 8) These data show that the ... FLAG 381 localized to the cytoplasm (Fig 9C) This is in agreement with our cell fractionation data, which also indicated that it is localized to the cytosol (data not shown) cin l my C SO G13 afilo...
- 18
- 483
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
... 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ... Ready cDNA (Clontech laboratories, Woerden, the Netherlands) was used to amplify MPP3 Primer pair 5¢-GATCCCGGGCCAGCATGCC AGTGCTATCGGAGG-3¢ (sense) and 5¢-GATCGTCGAC TTACCTGACCCAACTAACAGG-3¢ (antisense) ... further on it In human retina, MPP3 was detected at the SAR adjacent to adherens junctions at the OLM, and at the OPL In mouse retina, Mpp3 was detected at the SAR of the OLM, and at the OPL and...
- 14
- 449
- 0
how the use of the diary form narrative is beneficial to the
... descriptions, facts, that represents a group as a whole and the reader can feel as if they are part of the group and read, and think along with the characters Another thing dealing with the diary form is ... happen when the diary form of narrative is used For instance, after Lucy had written what was happening to her when her mother passed away, the story went back in time for another important matter ... exactly how a person was talking and acting through the written dialects In the novel Dracula, all the diaries, of all the individuals come together and in the end, become one powerful, combination...
- 2
- 473
- 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005
... Phoenicians to take to the sea and to become famous maritime traders of the ancient world This seafaring tradition began as early as the Bronze Age, and their voyages not seem to have been confined to ... into Apulia by enterprising farmers from the opposite Balkan coast in search of new land to cultivate From this region, agriculture may have gradually spread into other areas of Italy as the farming ... related to one another than they are to Umbrian, while Oscan and Umbrian are themselves clearly kindred and are even grouped together by historical linguists into a larger Sabellian class of Italic...
- 421
- 379
- 0
Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot
... analogs was selected and a standard plaque reduction assay was used to evaluate the susceptibility of the dUTPase mutant and the parent virus The mutant remained fully sensitive to all of the drugs ... of the downstream flank from F2L was made using primers IDT 717 (GCGCTCGAGAGGGTTTGGATCAACAGGAC, XhoI site underlined) against F2L residues 417–436 and IDT 7 18 (CATACATCGTCTACCCAATTCGG) against ... experiments and analysis of the data KAK contributed to the acquisition and interpretation of data RWM contributed to the conception of the studies and the critical review of the manuscript PCT...
- 6
- 330
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... technical assistance This study was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases References For quantitation of pulmonary CTL (from BALB/c ... (amino acids 82 to 90) [10,25] (provided by the NIAID Tetramer Facility, Yerkes Regional Primate Research Center, Atlanta, GA) and fluorescein isothiocyanate-conjugated rat anti-mouse CD8 monoclonal ... for an RSV or influenza virus epitope or stimulated in vitro with the epitope-specific peptide, stained for intracellular IFNγ and analyzed by flow cytometry Percentages relative to total CD8+...
- 8
- 381
- 0
Boundary Value Problems This Provisional PDF corresponds to the article as it appeared upon doc
... illustrate the applicability of our approach to three Dirichlet boundary value problems: the linear one, the semilinear one, and the quasi-linear one containing the p-Laplace operator Finally, ... Corresponding author: pnecesal@kma.zcu.cz Email addresses: AR: ronto@math.cas.cz MR: matronto@gold.uni-miskolc.hu GH: gabriela@kma.zcu.cz Department Abstract The article deals with approximate solutions ... condition of f is not satisfied Thus, we have to take into account the following additional assumptions on D in order to satisfy the assumption (A2 ): for < p < 2, we have to ensure that −ε < a1 ...
- 29
- 355
- 0
Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx
... for association and a 53% power R1202 Arthritis Research & Therapy Vol No Dieudé et al Table Linkage analysis of the PTPN22- 185 8T allele to rheumatoid factor-seropositive (RF+) rheumatoid arthritis ... factor Transmission, percentage of heterozygous 185 8C/T parents transmitting the 185 8T allele The plan was to test the hypothesis for RF+ RA; analysis for all RA and RF- RA were provided for the ... FC analyzed and interpreted the data LM, SL and TB made a substantial contribution to the acquisition of clinical data and the follow-up of the patients All authors read and approved the final...
- 8
- 342
- 0
Báo cáo y học: "This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon." ppsx
... other than lung transplantation currently available, yet The aim of this report is to describe two further cases of this rare disease, reviewing CT, clinical and histological features Letter to ... lung marks this disease as a entity.In routine chest X-rays it is quite common to report bilateral apical thickening of the pleura, especially in adult patients or when there is a clinical history ... in apical caps Differential diagnosis could be often reached on the basis of clinical and radiological features IPPFE is an interstitial lung disease in opposite to apical cap [2,3] It needs to...
- 15
- 320
- 0
Retrovirology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully docx
... is published in a subscription journal and the other published in an OA journal The paying reader can read both papers; the non-paying person can read only the OA paper This is “unequal” access ... pay Can equal access be had by the “haves” and the “have nots”? To the extent that the subscription and OA tracks will likely co-exist, the foreseeable future is a “separate and unequal” reality ... and Infectious Diseases (NIAID) The author thanks Mark Wainberg, Ben Berkhout, Yun-Bo Shi, Deborah Kahn, and Michaela Torkar for critical readings of this editorial Reference List Wainberg MA,...
- 5
- 154
- 0
Retrovirology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully ppt
... [13] In addition, mAbs against chemokine receptors have also been shown to have a potential for HIV-1 inhibition For example, an anti-human CCR2 mAb that is neither an agonist nor an antagonist blocks ... Kato N, Tanaka Y: New monoclonal antibodies against a recombinant second envelope protein of Hepatitis C virus Microbiol Immunol 19 98, 42 :87 5 -87 7 42 :87 523 Takahashi Yoshida A, Tanaka R, Murakami ... Mineki Saito , Yoshiaki Takahashi , Aftab A 1§ Ansari and Yuetsu Tanaka Department of Immunology, Graduate School of Medicine, iversity of the Ryukyus, Okinawa, Japan Department of Pathology,...
- 32
- 191
- 0
Báo cáo y học: "Does serum procalcitonin have a diagnostic value in febrile adult patients presenting to the emergency department" potx
... that, in contrast to the etiological diagnosis of the emergency physician found in the medical chart, we observed that administration of antibiotics was not always in accordance with that diagnosis, ... adverse postoperative outcome after cardiac surgery A comparative study between coronary artery bypass graft, valve, and combined cardiac surgery Crit Care 2007, 11:R106 Christ-Crain M, Jaccard-Stolz ... clinical diagnosis with likelihood ratios Lancet 2005, 365:1500-1505 Amour J, Birenbaum A, Bertrand M, Langeron O, Coriat P, Riou B, Bernard M, Hausfater P: Valeur diagnostique de la procalcitonine...
- 2
- 260
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... in its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... in the cited registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the...
- 8
- 416
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25