6 2 result of the searchengines servlet when the form of figure 6 1 is submitted
học tốt tiếng anh chapter 2 determination of MICs 2006updated (1)
... 0. 06- 8 1- 8 2- 16 1- 16 1- 12 8 1- 16 Ciprofloxacin 0.004- 12 8 0. 015 - 12 8 0.0 02- 0. 06 0.0 01- 0. 12 2-8 0. 06- 12 8 0. 12 - 4 0 .25 - 12 8 0 .25 - 12 8 Clarithromycin - - 1- 32 0. 015 -1 0.03 -2 0.03- 12 8 0. 015 - 16 0.03- 12 8 ... 0. 12 - 16 0.03- 12 8 0. 015 - 16 0.03- 12 8 0.03- 12 8 0.008- 12 8 0. 12 - 16 0.004-0.03 0.0 01- 0. 12 0. 12 - 1 0. 06- 0 .25 0. 12 - 1 0 .25 - 12 8 0. 12 - 12 8 - - - 4 -64 - - - - - 4- 12 8 - - 0.5- 32 - 0 .25 -8 - - 0. 06- 32 - 0.5 -20 48 ... 0.0 01- 0. 12 4- 12 8 0. 06- 12 8 0.004-0. 12 1- 12 8 Cefpodoxime 0. 06- 12 8 0 .25 - 12 8 0. 06- 0.5 0.0 02- 0. 06 8- 12 8 1- 12 8 0. 015 -0. 12 1- 12 8 0.03-4 Ceftazidime 0.004- 12 8 0 .25 - 12 8 0. 015 -0.5 0.004-0.5 4- 12 8 2- 12 8 ...
- 19
- 234
- 0
Báo cáo khoa học: Expression of heme oxygenase-1 is repressed by interferon-c and induced by hypoxia in human retinal pigment epithelial cells pot
... S 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 (20 00) Repression of heme oxygenase -1 by hypoxia in vascular endothelial cells Biochem Biophys Res Commun 27 1, 66 5 67 1 Shibahara, S (20 03) The ... oxygenase -1 cDNA, pHHO1 [8], and the HinfI/HinfI fragment of human heme oxygenase -2 cDNA, pHHO2 -1 [19 ] The northern probe for human Bach1 mRNA was the Pst1 fragment of human Bach1 cDNA [ 41] The human ... stresses [ 21 ,24 ,25 ] These results support the notion that expression of HO -1 is important in the survival and maintenance of RPE in the adult retina On the other hand, we have shown that HO -1 expression...
- 9
- 420
- 0
Báo cáo khoa học: A monoclonal antibody, PGM34, against 6-sulfated blood-group H type 2 antigen, on the carbohydrate moiety of mucin doc
... 4 .23 1 .20 10 3.8 72. 0 74.5 72. 2 71. 1 18 .2 99.4 67 .8 71. 7 69 .5 66 .4 15 .2 5 .19 3.74 3.78 3.77 4 .18 1. 19 1 02 .6 71 .2 74.4 72. 1 69 .7 18 .0 99.4 67 .8 71. 7 69 .5 66 .4 15 .2 5 .19 3.74 3.78 3.77 4 .17 1. 19 ... 9 76, 1 12 1 and 11 79, respectively, indicating that A1-5* A1 -6 [M–H]– (m ⁄ z) Expected composition of oligosaccharide-alditols 67 5 8 71 67 5 822 830 8 71 1 017 879 9 76 10 17 9 76 1 12 1 11 79 11 79 1 325 ... Standardsb 13 C 3 .68 ⁄ 3.74 4.35 4. 02* 3.43 4 .27 3 . 62 ⁄ 3.9* 2. 03 3. 72 ⁄ 3. 76 4.35 4.04* 3.47 4 .20 3 .64 ⁄ 3.9* 2. 02 63 .0 54 .2 77 .1* 71 .6 70 .6 73.9* 25 .0 61 .5 51. 5 68 .4 69 .4 69 .8 63 .2 21. 7 4.53 3.73 3 .64 ...
- 16
- 296
- 0
The JSP Files (Part 2) - Attack of the Killer Fortune Cookies
... here's the output: Adding It All Up The JSP Files (part 2) : Attack Of The Killer Fortune Cookies The The The The The sum of 25 and is 30 difference of 25 and is 20 product of 25 and is 12 5 quotient ... And if the two strings are identical, the comparison will return Incidentally, the comparison is based on both the first character of the string, and the number of characters in Flavour Of The Month ... "dayOfWeek" variable − this is because the "switch" construct only works when the decision variable is an integer There are also a couple of important keywords here: the "break" keyword is used...
- 18
- 325
- 0
Đầu cáp và Hộp nối cáp hạ thế – 0,6/1(1,2)kV
... cách is under testing điện giấy, có giáp / không giáp, cấp điện áp 3 ,6/ 6(7 ,2) kV, 3,8 /6, 6(7 ,2) kV, 6/ 10 ( 12 ) kV, 6, 35 /11 ( 12 ) kV, 8,7 /15 (17 ,5)kV, 12 / 20 (24 )kV, 12 , 7 /22 (24 )kV, 18 /30( 36) kV, 19 /33( 36) kV, 20 ,8/ 36( 42) kV ... for 3 .6/ 6(7 .2) kV, 3.8 /6. 6(7 .2) kV, 6/ 10 ( 12 ) kV, 6. 35 /11 ( 12 ) kV, 8.7 /15 (17 .5)kV, 12 / 20 (24 )kV, 12 . 7 /22 (24 )kV, 18 /30( 36) kV, 19 /33( 36) kV, 20 .8/ 36( 42) kV Consists of indoor & outdoor termination and straight ... breakdown or flashover 10 3MΩ 12 5 kV No breakdown or flashover 32 kV Pass 22 kV
- 11
- 1,417
- 0
Tài liệu LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 6-1 pptx
... shattered, in the evening But now the spell had been upon him eight-and-forty hours, and he lay there, doubtless among the dregs of the docks, breathing in the poison or sleeping off the effects There ... turned upon the newcomer Out of the black shadows there glimmered little red circles of light, now bright, now faint, as the burning poison waxed or waned in the bowls of the metal pipes The most ... it was She had the surest information that of late he had, when the fit was on him, made use of an opium den in the farthest east of the City Hitherto his orgies had always been confined to one...
- 13
- 418
- 0
Tài liệu Lab 6.2.3 Managing the MAC Address Table pdf
... ALSwitch(config-line)#interface Vlan1 ALSwitch(config-if)#ip address 1 92. 16 8 .1 .2 255 .25 5 .25 5.0 ALSwitch(config-if)#no shutdown ALSwitch(config-if)# ALSwitch(config-if)#ip default-gateway 1 92. 16 8 .1. 1 ALSwitch(config)# ... All 0009.b7f6 . 61 c0 STATIC CPU All 010 0.0ccc.cccc STATIC CPU All 010 0.0ccc.cccd STATIC CPU All 010 0.0cdd.dddd STATIC CPU 00 01. 02 76. 8eec DYNAMIC Fa0 /1 00 01. 02 76. 90dd DYNAMIC Fa0/4 Total ... All 0009.b7f6 . 61 c0 STATIC CPU All 010 0.0ccc.cccc STATIC CPU All 010 0.0ccc.cccd STATIC CPU All 010 0.0cdd.dddd STATIC CPU 00 01. 02 76. 8eec DYNAMIC Fa0 /1 00 01. 02 76. 90dd DYNAMIC Fa0/4 Total...
- 7
- 524
- 0
Tài liệu Lab 6.2.3 Managing the MAC Address Table docx
... ALSwitch(config-line)#interface Vlan1 ALSwitch(config-if)# ip address 1 92. 16 8 .1 .2 255 .25 5 .25 5.0 ALSwitch(config-if)# no shutdown ALSwitch(config-if)# ALSwitch(config-if)#ip default-gateway 1 92. 16 8 .1. 1 ALSwitch(config)# ... - - All 0009.b7f6 . 61 c0 STATIC CPU All 010 0.0ccc.cccc STATIC CPU All 010 0.0ccc.cccd STATIC CPU All 010 0.0cdd.dddd STATIC CPU 00 01. 02 76. 8eec DYNAMIC Fa0 /1 00 01. 02 76. 90dd DYNAMIC Fa0/4 Total ... STATIC CPU All 010 0.0ccc.cccd STATIC CPU All 010 0.0cdd.dddd STATIC CPU 00 01. 02 76. 8eec DYNAMIC Fa0 /1 00 01. 02 76. 90dd DYNAMIC Fa0/4 Total Mac Addresses for this criterion: ALSwitch# 6- 7 CCNA 3: Switching...
- 7
- 424
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... al 24 25 26 27 28 29 30 31 32 33 34 35 36 Yoshida T (19 95) Heme oxygenase -2 Properties of the heme complex of the purified tryptic fragment of recombinant human heme oxygenase -2 J Biol Chem 27 0, ... [ 12 , 13 ] and treatment with interferon-c [14 ,15 ] or desferrioxamine, an iron chelator [ 12 ] Likewise, the expression of HO -2 is decreased in the placental tissues of abnormal pregnancies [ 16 , 17 ] ... with HO -2 siRNA in HepG2 cells These results indicate that the down-regulation of HO -2 expression is associated with induction of HO -1 expression FEBS Journal 27 3 (20 06) 5333–53 46 ª 20 06 The Authors...
- 14
- 487
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... mass 11 818 .87) and Pyr-ONC (M23L) (theoretical molecular mass 11 8 01 .60 ), and expressing it as the fraction of hydrolyzed (Met1)-ONC (M23L) Figure shows the results of the characterization of the ... 0 .1 26 9 0 .11 33 M M 0.0 728 0.0734 0.0834 M 0. 067 0. 066 0. 067 on pH in the range 6. 2 8.0 Interestingly, however, the reaction is slowed down when the guanidinium chloride concentration increases These ... other methods for the production and purification of the enzyme [13 ] The molecular mass of each purified product, as measured by MALDI-TOF MS, was 11 947.87 2 for (Met1)-ONC (M23L) and 11 838 . 21 ±2...
- 9
- 704
- 0
Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc
... TA (19 97) Isolation and characterization of a novel epithelium-specific transcription factor, FEBS Journal 27 2 (20 05) 16 7 6– 16 8 7 ª 20 05 FEBS F T Grall et al 24 25 26 27 28 29 30 31 32 ESE -1, a ... (20 05) 16 7 6– 16 8 7 ª 20 05 FEBS ESE -1 activates COX -2 expression 33 34 35 36 37 38 39 40 41 expression by ETS transcription factors Oncogene 14 , 26 5 1 26 6 0 White LA, Maute C & Brinckerhoff CE (19 97) ... ESE -1, we found that ESE -1 is a more effective transactivator of the COX -2 promoter than PEA3, further FEBS Journal 27 2 (20 05) 16 7 6– 16 8 7 ª 20 05 FEBS ESE -1 activates COX -2 expression supporting the...
- 12
- 519
- 0
Tài liệu Ave Roma Immortalis, Vol. 2 Studies from the Chronicles of Rome pdf
... Farnese 18 The Pantheon 46 The Capitol 68 General View of the Roman Forum 94 Theatre of Marcellus 11 0 Porta San Sebastiano 13 0 The Roman Forum, looking west 15 4 The Palatine 1 86 Castle of Sant' ... of 10 1 Piazza Montanara and the Theatre of Marcellus 1 06 Site of the Ancient Ghetto 11 4 Region XII Ripa, Device of 11 9 Church of Saint Nereus and Saint Achilleus 12 5 The Ripa Grande and Site of ... Vatican 23 5 Fountain of Acqua Felice 24 2 Vatican from the Piazza of St Peter's 25 1 Loggie of Raphael in the Vatican 25 9 Biga in the Vatican Museum 26 8 Belvedere Court of the Vatican 27 2 Sixtine...
- 129
- 528
- 1
Báo cáo khoa học: Retrocyclin RC-101 overcomes cationic mutations on the heptad repeat 2 region of HIV-1 gp41 ppt
... for each axis has been restricted in order to clearly visualize the isoelectric points of the majority of HR1 and HR2 molecules (n ¼ 569 ), 11 (n ¼ 14 0), 11 . 71 (n ¼ 58) and 12 . 01 (n ¼ 12 ) Sequences ... process Biochemistry 40, 12 2 31 12 2 36 Dimitrov AS, Louis JM, Bewley CA, Clore GM & Blumenthal R (20 05) Conformational changes in HIV -1 gp 41 in the course of HIV -1 envelope glycoprotein- RC -10 1 overcomes ... the region that binds HR1 upon 6HB formation The strong affinity of RC -10 1 for HR2 prevents the interaction of HR1 and HR2, formation of the 6HB, and subsequent fusion of the host and viral membranes...
- 11
- 351
- 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx
... 6 Mana1 Mana1fi3 a1fi6Mana1fi6Mana1fi6Mana1 6 2 Mana1 a1fi6Mana1fi6Mana1fi6Mana1 6 > > 2 2 2 > > = Mana1 a1fi6Mana1fi6Mana1fi6Mana1 6 > 2 > > > a1fi2Mana1 ; a1fi6Mana1fi6Mana1fi6Mana1 6 2 2 2 a1fi2Mana1 ... a1fi2Mana1 Mana1 2 Mana1 6 a1fi6Mana1 6 a1fi3Mana1 2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1 2 Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 ... Manb1fi2Mana1fiphosphate Manb1fi2Manb1fi2Mana1fiphosphate a1fi2Mana1fi3Mana1 2 a1fi3Mana1fi2Mana1fi3Mana1 2 6 6 Mana1 Mana1 Mana1fi2Mana1 2 a1fi2Mana1fi2Mana1 2 b1fi2Mana1fi2Mana1 2 a1fi3Mana1fi2Mana1fi2Mana1fi2...
- 11
- 456
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... 59 63 11 Beckman, K.B & Ames, B.N (19 98) The free radical theory of aging matures Physiol Rev 78, 547–5 81 12 Stadtman, E.R (19 92) Protein oxidation and aging Science 25 7, 12 2 0– 12 2 4 Ó FEBS 20 02 ... rat cardiomyocytes Am J Pathol 1 52, 11 51 11 56 66 Salvesen, G.S (20 01) A lysosomal protease enters the death scene J Clin Invest 10 7, 21 22 67 Brun, A & Brunk, U (19 73) Heavy metal localization ... suggest lack of senescence in hydra Exp Gerontol 33, 21 7 22 5 17 Hayflick, L (1 965 ) The limited in vitro lifetime of human diploid cell strains Exp Cell Res 37, 61 4 63 6 18 Campisi, J (19 96) Replicative...
- 7
- 444
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GCTGAAGGAGACGATGAGGGTGA 828 98– 829 23 835 81 835 52 914 89– 915 17 924 31 924 04 787 72 78800 79 013 –789 81 21 0 23 7 65 7 63 1 705– 728 967 –943 12 8 8 13 03 1 427 14 07 68 54 68 76 764 6– 7 62 4 NC_0000 76 Idem obtained represent ... Job D (19 98) STOP FEBS Journal 2 76 (20 09) 711 0–7 12 3 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 7 12 1 Neurite formation in CAD cells 24 25 26 27 28 29 30 31 32 33 34 35 36 37 C G Bisig et ... 6, 25 97– 26 0 6 42 Bershadsky AD & Gelfand VI (19 81) ATP-dependent regulation of cytoplasmic microtubule disassembly Proc Natl Acad Sci USA 78, 3 61 0– 3 61 3 43 Halpain S & Dehmelt L (20 06) The MAP1...
- 14
- 416
- 0
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc
... mediated apoptosis J Biol Chem 28 2, 16 7 92 16 8 02 13 Mukhopadhyay R, Ray PS, Arif A, Brady AK, Kinter M & Fox PL (20 08) DAPK–ZIPK–L13a axis 14 15 16 17 18 19 20 21 22 23 24 25 26 constitutes a negative-feedback ... Journal 27 8 (20 11 ) 354–370 ª 20 10 The Authors Journal compilation ª 20 10 FEBS Y Lin et al TSC2 promotes the degradation of DAPK A TSC2 TSC2 (1 15 16 ) IB: FLAG IP: TSC1 IB: TSC1 TSC2 TSC2 (1 15 16 ) IB: ... TSC1 Lysate IB: Actin FLAG–TSC2 FLAG–TSC2 (1 15 16 ) B – + + – TSC2 FLAG TSC1 TSC2 (1 15 16 ) TSC1 FLAG Actin FLAG–TSC2 + + FLAG–TSC1 – + C TSC2 TSC2 (1 15 16 ) IB: FLAG IB: TSC1 IP: TSC1 with TSC1,...
- 17
- 368
- 0
Civil Society 2.0?: How the Internet Changes State-Society Relations in Authoritarian Regimes: The Case of Cuba potx
... Introduction Civil Society in the 19 90s: The Quest for Associational AutonomyAlong with its Limits Enter the Internet: The Public Sphere in Transnational Times Asserting Citizenship: The Public Sphere and ... Â Debating Cuban Exceptionalism, London/New York: Palgrave, 20 07 (edited with Laurence Whitehead). hoffmann@giga-hamburg.de ÊÊ Đ
ỷ ... Public Sphere in Transnational Times Asserting Citizenship: The Public Sphere and Civil Society in the Internet Era From Voice via Web to Civil Society Action? Conclusions Ă Ê ...
- 32
- 335
- 0
The Cavaliers of Virginia, vol. 1 of 2 pptx
... Clerk's Office of the District Court of the Southern District of New-York THE CAVALIERS OF VIRGINIA CHAPTER I CHAPTER I The romance of history pertains to no human annals more strikingly than to the ... subjected to the sway of the Roundheads and Royalists First came the Cavaliers who fled hither after the decapitation of their royal master and the dispersion of his army, many of whom became ... replied Frank, as the landlord moved up his chair nearer to the table, more than ever on the qui vive, when the Cross Keys became the subject of discussion "There is no one in the Tap of the Keys, as...
- 85
- 426
- 0
The Conquest of Canada (Vol. 1 of 2) docx
... from the year 10 07 to 18 11 The name of the colonized countries is found in the ancient national songs of the natives of the Fọrửe Islands. Humboldt's Cosmos, vol ii., p 26 8 -4 52. ] [Footnote 24 : ... extension of his patent Despite his disappointments, he fitted out some vessels in the spring of 16 0 8, with the assistance of the company, and dispatched them to the River St Lawrence on the 13 th of ... in the West was unknown to the ancients, there is no doubt that they entertained a suspicion of its existence; [11 ] the romance of Plato the prophecy of Seneca, were but the offsprings of this...
- 199
- 396
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25