5 4 hrr history under external heat flux for a hdpe and b pc

Pyrolysis and combustion processes of combustible materials under external heat flux

... about 0.11) initial/ambient conditions 25 25 kW/m2 heat flux 50 50 % mass loss or 50 kW/m2 heat flux 75 75 kW/m2 heat flux -xxiii- Abbreviations ABS acrylonitrile butadiene styrene CFD computational ... 120 5. 4 HRR history under external heat flux 123 5. 5 MLR history under external heat flux 126 5. 6 Comparisons of average MLR under different heat flux 128 5. 7 Comparisons of gas ... modeling and experiments for PC under 75 kW/m2 heat flux 212 7 .48 Temperatures inside PC slabs under 50 kW/m2 heat flux 213 7 .49 Temperatures inside PC slabs under 75 kW/m2 heat flux...

Tài liệu Preface, Contents Product Overview Getting Started1 2 3 4 5 6 7 8 9 10 11 12 A B C D E F pdf

Danh mục: Tài liệu khác

... Chapter Format: AC[accumulator number] AC0 MSB AC2 (accessed as a byte) AC1 (accessed as a word) MSB 15 LSB LSB Most significant Least significant Byte Byte AC3 (accessed as a double word) MSB ... the length byte, so the maximum length for a string is 255 bytes Length Character Character Character Byte Character Byte Byte Byte Byte Figure 4- 9 Character 2 54 /b> Byte 2 54 /b> Format for Strings ... S7-200 and related equipment Install and operate all equipment according to all applicable national and local standards Contact your local authorities to determine which codes and standards apply...

494
3,580
0

HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc

Danh mục: Tài liệu khác

... 4- 6 Table 4- 7 Table 4- 8 Table 4- 9 Table 4- 10 Table 4- 11 Table 5- 1 Table 5- 2 Table 5- 3 Table 5- 4 Table 5- 5 Table 5- 6 Table 5- 7 Table 5- 8 Table 6-1 Table 6-2 Table 6-3 Table 6 -4 Table 7-1 Table ... V4.0, Service Manual 4- 35 4- 38 4- 39 4- 42 4- 43 4- 44 4 -49 4 -51 4 -52 4 - 54 /b> 4 -56 4 -57 4 -58 4 -59 4- 62 4- 63 4- 64 4- 65 4- 66 4- 67 4- 68 4- 71 4- 73 4- 75 4- 76 4- 76 4- 77 4- 83 4- 86 4- 89 4- 89 0-19 hp3hp5shLOF.fm ... Table 3-31 Table 3-32 Table 3-33 Table 3- 34 Table 3- 35 Table 3-36 Table 3-37 Table 3-38 Table 3-39 Table 3 -40 Table 3 -41 Table 3 -42 Table 3 -43 Table 3 -44 Table 3- 45 Table 3 -46 Table 3 -47 Table...

860
6,396
0

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Danh mục: Y học thưởng thức

... preparation and flow cytometry Arterial blood was collected from septic patients on the day sepsis was diagnosed (day 0) and on days 3, 7, and 14 for PCR studies and days 0, 1, and for measurement ... ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, Denmark) were coated overnight at 4 C ... Crit Care Med 20 04; 169(10):1 144 -51 Rosa F, Hatat D, Abadie A, Wallach D, Revel M, Fellous M Differential regulation of HLA-DR mRNAs and cell surface antigens by interferon EMBO J 1983;2: 158 5-9...

Báo cáo khoa học: Identiﬁcation and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Danh mục: Báo cáo khoa học

... 14 158 24 35 383 267 1 04 103 75 87 157 49 90 177 119 107 2 850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga ... TGAGCAAAGTCTTCAATG-3¢ and 5 -GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5 -GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5 -GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5 -GGAATTCATGCCGACCACAACCGTT ... 157 49 90 176 119 107 277 AGAGTAaagt GCCAAGacgt GAGAAAgagt TTGCAGgaga ACCACGgggt CTGCAGgcgg ACCACGgcgt CACACGacgt GACCAGgggt CTGAAGgatg CTCAGGgagt GGACGGgagt 21707 137 15 253 45 8 44 0 50 1 2 746 48 6...

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Danh mục: Báo cáo khoa học

... Production of antibodies against t 25) 40 peptide Anti-(t 25) 40 ) polyclonal Ig was raised in rabbit against the t 25) 40 peptide covalently coupled to BSA The t 25) 40 –BSA conjugate was obtained by reaction ... same contact; mutations at this interface interfere with the Ó FEBS 2003 41 42 43 44 45 46 47 48 49 50 51 52 Amphiphilic a helical domain of the AChE T subunit (Eur J Biochem 271) 47 C-terminal ... internal salt bridges between residues D4 or E5 and R8, between E7 and K11, and between E13 and R16, as analyzed in a further ´ study (S Belbeoc’h, J Leroy, A Ayon, J Massoulie & S Bon, unpublished...

the handbook of international adoption medicine a guide for physicians parents and providers dec 2004

Danh mục: Vật lý

... 20 05 Oxford New York Auckland Bangkok Buenos Aires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi São Paulo Shanghai ... Additional information on all topics addressed in this book is available in many standard texts as well as on the Internet Every effort has been made to ascertain the accuracy and availability ... Adoption has always been a part of human history Adoption is mentioned in the Babylonian code of Hammurabi (22 85 BC) and the Hindu Laws of Manu (200 BC), and was practiced by the ancient Romans, Greeks,...

báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt

Danh mục: Hóa học - Dầu khí

... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently ... falls may further predispose themselves to falls and instability by increasing their stride-to-stride variability A small perturbation could then take an already unstable system and cause a fall ... vestibular and proprioceptive feedback When older adults or persons with deficits in balance are asked to close their eyes while standing on a balance platform, measures of sway and postural instability...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part1 ppt

Danh mục: Kế toán - Kiểm toán

... homesteads to native Hawaiians who have at least 50 percent Hawaiian blood Homestead leases may extend up to 199 years for an annual rental fee of $1 The department is also authorized to lease land ... maintained and financial reporting and audits should be completed on a timely basis Written policies and procedures for the collection of lease and license receivables should be established and ... condition We also found that management has failed to ensure that all departmental accounting policies and procedures are in place and enforced This could cost the State and Hawaii’s taxpayers millions...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part2 pdf

Danh mục: Kế toán - Kiểm toán

... and experience about past and current events and assumptions about current conditions The estimated amount for doubtful accounts must be reasonable and supported by relevant information and adequate ... Division manages those Hawaiian home lands not used for homestead purposes, including residential, agricultural, and pastoral lands It manages and disposes of unencumbered lands for both long- and ... deductions and other disbursements have been made and all revenues or additions and other receipts have been collected and accounted for in accordance with federal and state laws, rules and regulations,...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part3 pdf

Danh mục: Kế toán - Kiểm toán

... intervals and preparing reports to facilitate loan monitoring The department should maintain current and accurate information on all guaranteed loans Agencies that hold loans guaranteed by the department ... or accurate Applicants may have been on the waiting list for as many as 40 to 50 years, and the department may not have current information to reach these applicants Thus, the department cannot ... is primarily due to the fact that applicants may submit two applications, one for a residential lot and the other for either agricultural or pastoral land The cumulative leases awarded as of June...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part4 doc

Danh mục: Kế toán - Kiểm toán

... we plan and perform the audit to obtain reasonable assurance about whether the combined financial statements are free of material misstatement An audit includes examining, on a test basis, evidence ... the overall financial statement presentation We believe that our audit provides a reasonable basis for our opinion The department has loans receivable of $43 ,4 95, 320, net of an allowance for losses ... America and the standards applicable to financial audits contained in Government Auditing Standards, issued by the Comptroller General of the United States Those standards require that we plan...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part5 pdf

Danh mục: Kế toán - Kiểm toán

... payable from and collateralized by the department’s revenues from available lands and are due in annual installments through July 1, 2011 The balance of bonds payable as of June 30, 2001, are ... 20 05; $ 45 , 740 on April 1, 2006; $48 ,137 on April 1, 2007; $50 , 54 /b> 8 on April 1, 2008; and $53 ,0 74 on April 1, 2009; interest at 5. 00% to 5. 25% payable semi-annually 321 ,47 2 $1, 746 ,707 The annual requirements ... General LongTerm Debt, Bonds Payable $17 ,50 5,000 – – $17 ,50 5,000 $4, 680,772 $2,209, 8 54 /b> $2, 146 ,703 $26 , 54 /b> 2,329 The changes in general long-term debt were as follows: Accrued Vacation Bonds Total Balances...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part6 doc

Danh mục: Kế toán - Kiểm toán

... Statement No 34, Basic Financial Statements – and Management’s Discussion and Analysis – for State and Local Governments This Statement establishes financial reporting standards for state and local governments ... Home sales (Note G) Other $ 3 ,56 4, 159 - 3 ,56 4, 159 1,110,7 35 16, 257 ,7 14 ( 15, 146 ,979) 2, 45 3 ,42 4 12, 355 ,811 11, 8 54 /b> ,52 9 182,909 221,766 96,607 14, 809,2 35 6, 150 ,52 0 9 84 ,59 8 6,898, 757 69,000 246 , 253 46 0,107 ... 1, 359 , 54 /b> 6 $1, 359 , 54 /b> 6 - Actual General Fund $ $ - - 55 ,910 - - 55 ,910 55 ,910 55 ,910 - Variance Favorable (Unfavorable) - - (1,7 84, 652 ) 14, 461, 652 14, 461, 652 - 12,677,000 6,100,000 606,000 5, 670,000 301,000...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part7 doc

Danh mục: Kế toán - Kiểm toán

... 30, 2001 10, 850 ,100 - 10, 850 ,100 - - - - - - - - $ 10, 850 ,100 $ Trust Fund 1 05, 557 , 059 (3 ,50 4, 000) 109,061, 059 3 ,56 4, 159 1,110,7 35 16, 257 ,7 14 ( 15, 146 ,979) 2, 45 3 ,42 4 12, 355 ,811 11, 8 54 /b> ,52 9 182,909 ... 337 ,56 8 69,000 27,929 Administration Account and Other $ $ 14, 048 ,40 6 13,393, 258 - 13,393, 258 655 , 148 - - 655 , 148 648 ,030 629,327 18,703 - 1,303,178 248 ,40 6 808,393 246 , 253 126 Native Hawaiian ... Homes sales Other Home Loan Fund 5, 277 , 54 /b> 9 4, 862, 741 96 ,4 35 221,766 96,607 4 65, 199 33, 147 43 2, 052 $10, 958 ,55 2 11,1 74, 612 - 11,1 74, 612 (216,060) 4 ,59 6,290 4 ,59 6,290 - (4, 812, 350 ) $ Operating Fund...

Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part8 pot

Danh mục: Kế toán - Kiểm toán

... Public Accountants Chainnan Hawaiian Home Lands Commission State ofHawaii We have audited the accompanying combined ~cia1 statementsof the Department of Hawaiian Home Lands, State of Hawaii, as ... of approx'mately 300 -50 0 homesteads per year Total applications hav applications per year lands program is dire homestead production a the last decade Whi applicants who "may as many as 40 or 50 ... such adjustment is appropriate andihas been properly applied We conducted our audit in accordancewith au~ ting standards generally accepted in the United States of America and the standards applicabl...

Financial Audit of the Department of the Attorney General A Report to the Governor and the Legislature of the State of Hawai`i Report No. 04-05 May 2005_part1 ppt

Danh mục: Kế toán - Kiểm toán

... Financial Reporting and on Compliance and Other Matters Based on an Audit of Financial Statements Performed in Accordance with Government Auditing Standards 20 Description of Basic Financial ... Act and administers Chapter 57 6D, HRS, in accordance with Title IV-D and applicable state laws The Crime Prevention and Justice Assistance Division serves as a central agency for the maintenance ... investigations, and opinions and advice The division also contains a bankruptcy unit devoted to handling all bankruptcy cases for the Departments of Taxation and Human Services The division also...

Financial Audit of the Department of the Attorney General A Report to the Governor and the Legislature of the State of Hawai`i Report No. 04-05 May 2005_part3 potx

Danh mục: Kế toán - Kiểm toán

... our audit in accordance with auditing standards generally accepted in the United States of America and the standards applicable to financial audits contained in Government Auditing Standards, ... Financial Reporting and on Compliance and Other Matters Based on an Audit of Financial Statements Performed in Accordance with Government Auditing Standards The Auditor State of Hawaii: Except as ... and significant estimates made by management, as well as evaluating the overall financial statement presentation We believe that our audit provides a reasonable basis for our opinions As discussed...

Financial Audit of the Department of the Attorney General A Report to the Governor and the Legislature of the State of Hawai`i Report No. 04-05 May 2005_part5 ppt

Danh mục: Kế toán - Kiểm toán

influence of binders on the sensing and electrical characteristics of wo3-based gas sensors

Danh mục: Vật lý

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25