4ar in breast cancerbreast cancer and possible interactions with er c srcc src and her family members
Báo cáo khoa học: "The combination effect of sodium butyrate and 5-Aza-2''''-deoxycytidine on radiosensitivity in RKO colorectal cancer and MCF-7 breast cancer cell lines" pot
... MS-PCR primers of specific genes analyzed in this study Sense primer (5'-3') MINT31(M31) CACAAAAACCCTCACTCACAACAA M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATA ... AACAAAAAACCTCAACCCCACA M TTGTTAAAGTGTTGAGTTCGTC AATAACGACGATTCCGTACG U MINT2(M2) TTTTTGGTGTTAAAGGGTGGTGTAGT U MINT1(M1) AAAACCCTCACTCGCGACG U E-cadherin GTGTTAAAGGGCGGCGTAGC U p16INK4a M U p14ARF ... CAACCCCAAACCACAACCATA M TTAGGTTAGAGGGTTATCGCGT TAACTAAAAATTCACCTACCGAC TAATTTTAGGTTAGAGGGTTATTGT CACAACCAATCAACAACACA M AATTTTTTTATATATATTTTCGAAGC AAAAACCTCAACCCCGCG AATTTTTTTATATATATTTTTGAAGTGT AACAAAAAACCTCAACCCCACA...
- 7
- 327
- 0
Báo cáo sinh học: "Clinical outcomes of active specific immunotherapy in advanced colorectal cancer and suspected minimal residual colorectal cancer: a meta-analysis and system review" pdf
... identifying antigens and describing immune interactions in cancer patients Many clinical trials have been conducted using active specific immunotherapy (ASI) in CRC, including autologous tumor cell ... Global cancer statistics, 2002 CA Cancer J Clin 2005, 55:74-108 Kerr D: Clinical development of gene therapy for colorectal cancer Nat Rev Cancer 2003, 3:615-622 Lorenz M, Staib-Sebler E, Hochmuth ... D, Thiel E: Clinical and Immunologic Responses to Active Specific Cancer Vaccines in Human Colorectal Cancer Clin Cancer Res 2006, 12:3064-3069 14 Alejandro R, Jadad MD, DPhil R, Andrew Moore...
- 11
- 539
- 0
Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt
... Liao CT, Wang HM, Yen TC, Chiu CC, Lu YC, Li HF, Cheng AJ: Head and neck cancer in the betel quid chewing area: recent advances in molecular carcinogenesis Cancer Sci 2008, 99:1507-1514 Ko YC, ... Lee CH, Chen MJ, Lin LM, Tsai CC: Betel quid chewing, cigarette smoking and alcohol consumption related to oral cancer in Taiwan J Oral Pathol Med 1995, 24:450-453 Clinical practice guidelines in ... Khaleque MA, Sawyer DB, Ciocca DR: Heat shock proteins in cancer: chaperones of tumorigenesis Trends Biochem Sci 2006, 31:164-172 10 Nicchitta CV: Biochemical, cell biological and immunological issues...
- 24
- 275
- 0
A Study of Elderly Living in Old Age Home and Within Family Set-up in Jammu pot
... that two socio-demographic characteristics (income and education) influence life satisfaction both directly and also indirectly through psychosocial factors such as activity-physical activity level, ... Awareness and acceptance of the fact that ageing has physiological, psychological and social determinants would make the ageing process acceptable, cheerful perhaps even desirable by making living ... families in case of older person has declined due to structural changes which have taken place in the Indian society and the concomitant disintegration of the joint family system, which results in...
- 6
- 916
- 0
36448 celia and her family
... (am/is/are) Celia and is trying her new eyeglasses (am/is/are) _ (am/is/are) _ _ and (am/is/are) _ _ () = can (x) = can’t () he...
- 3
- 63
- 0
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
... diagnostic for mucinous adenocarcinoma Dystrophic calcification occurs in ischemic and necrotic tissue Denatured proteins bind specifically to phosphate Page of ions and thereafter react with calcium ... necrosis with cystic degeneration may cause calcification [9-11] In our case, the CT scan years ago showed a cystic tumor with well circumscribed calcification in the stomach, but with greater ... have been reported in gastric cancer: mucin pool calcifications, psammomatous calcifications, and heterotopic ossification [9,12] In addition, four mechanisms of calcification within tumor have been...
- 4
- 231
- 0
European guidelines for quality assurance in breast cancer screening and diagnosis pot
... easier comparison with published incidence rates, since most cancer registries currently interpret breast cancer as invasive cancer (coded by ICD-9 174) and not include DCIS (coded by ICD-9 ... cancers diagnosed outside screening (interval cancers, cancers in non attenders, cancers in women not invited) All women with breast cancer detected at screening, with or without signs of distant ... registers, cancer registers, review of death certificates, etc In this respect, it is of interest to specify whether ductal carcinomas in situ (DCIS) or lobular carcinomas in situ (LCIS) are included in...
- 432
- 460
- 0
Cornell University Program on Breast Cancer and Environmental Risk Factors in New York State (BCERF) pptx
... Factors in New York State Smoking has effects that can both increase and decrease breast cancer risk On one hand, tobacco smoke contains chemicals that can cause breast cancer in animals and could ... different chemicals, including the toxic chemicals in tobacco Examinations of the connection between breast cancer risk and differences in the processing of these toxic tobacco chemicals have produced ... on Breast Cancer and Environmental Risk Factors in New York State breast cancer risk There is direct documentation that breasts are exposed to chemicals within tobacco smoke in active smokers...
- 5
- 443
- 0
Targeting New Pathways and Cell Death in Breast Cancer Edited by Rebecca L. Aft docx
... known HER ligands bind directly to HER2 with high affinity, heregulin, a cytokine secreted by the breast stromal cells, can activate HER2 by inducing or stabilizing heterodimers with other HER receptors ... showed single agent activity in treatment of breast cancers in a phase I trial, and conferred therapeutic benefits in combination with chemotherapy in triple-negative breast cancers without an increase ... other potent cytotoxic mechanisms will improve their apoptosis-inducing efficacy in breast cancers Second, additional approaches to achieving a “genuine” breast cancer targeting in drug delivery...
- 190
- 414
- 0
Breast cancer incidence and case fatality among 4.7 million women in relation to social and ethnic background: a population-based cohort study pdf
... Jensen and colleagues emphasizing the importance of early breast cancer detection in Sweden on decreasing breast cancer mortality [58] Our findings of higher breast cancer survival by increasing ... significantly higher incidence of breast cancer compared with their mothers However, lack of statistical power hindered any definitive conclusion because of wide confidence intervals at the country level ... national breast cancer screening in the Netherlands 1997-2008 Eur J Cancer Prev 2010, 19:195-198 Page 13 of 13 62 Coughlin SS, Wilson KM: Breast and cervical cancer screening among migrant and seasonal...
- 13
- 408
- 0
Báo cáo khoa học: BRCA1 accumulates in the nucleus in response to hypoxia and TRAIL and enhances TRAIL-induced apoptosis in breast cancer cells pdf
... BRCA1 increased, whereas the non-nuclear (cytoplasmic and perinuclear) level decreased In MCF-12A and HMEC cells, there was no difference in BRCA1 localization in cells exposed to hypoxia as compared ... Synergistic interactions of chemotherapeutic drugs and tumor necrosis factor-related apoptosisinducing ligand ⁄ Apo-2 ligand on apoptosis and on regression of breast carcinoma in vivo Cancer ... TRAIL and BRCA1 in regulating apoptosis in breast cancer cells Experimental procedures Cell culture MCF-7, MDA-MB-468, HCC1937 and MCF-12A cells were from the American Type Culture Collection...
- 10
- 392
- 0
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
... reduced by CCR9 blockade Figure CCL25 inhibits cisplatin-induced cell death OVCAR-3 and SKOV-3 cells were cultured with (circles) or 100 ng/ml of CCL25 plus isotype control (squares) or anti-CCR9 ... statistical significant differences (p < 0.01) between CCL25-treated and untreated OvCa cells CCL25-CCR9 interactions impact on PI3Kp85-phospho Tyr and Akt-Ser473 activation To determine the CCR9-mediated ... study investigates the role of CCR9 signalling on OvCa cell survival and cisplatin resistance We show for the first time that CCL25-CCR9 interactions in OvCa cells provide protection against cisplatin-induced...
- 8
- 316
- 0
TARGETING NEW PATHWAYS AND CELL DEATH IN BREAST CANCER pot
... known HER ligands bind directly to HER2 with high affinity, heregulin, a cytokine secreted by the breast stromal cells, can activate HER2 by inducing or stabilizing heterodimers with other HER receptors ... showed single agent activity in treatment of breast cancers in a phase I trial, and conferred therapeutic benefits in combination with chemotherapy in triple-negative breast cancers without an increase ... other potent cytotoxic mechanisms will improve their apoptosis-inducing efficacy in breast cancers Second, additional approaches to achieving a “genuine” breast cancer targeting in drug delivery...
- 190
- 305
- 0
Báo cáo y học: "Physical Exercise and Quality of Life in Breast Cancer Survivors" potx
... during cancer treatment: biopsychosocial outcomes Exerc Sport Sci Rev 2001;29:60-4 McTiernan A Physical activity after cancer: physiologic outcomes Cancer Invest 2004;22:68-81 Courneya KS Exercise ... USCenters for Disease Control and Prevention 2000:1–44 23 American Cancer Society Cancer Facts and Figures Atlanta, GA: American Cancer Society; 2001 24 Hortobagyi GH Treatment of breast cancer ... [22] There is a growing interest in the possible role of exercise in enhancing QOL, reducing recurrence and other diseases, and extending survival in cancer survivors Preliminary research suggests...
- 5
- 403
- 0
Báo cáo sinh học: " Genital tuberculosis in a tamoxifen-treated postmenopausal woman with breast cancer and bloody vaginal discharge" pot
... tuberculous infection or previous contact with persons suffering from TB In the present case, persistent questioning revealed the patient's prior close contact with infected persons Furthermore, the clinician ... ago, during the perimenopausal period, she was diagnosed with an infiltrating ductal carcinoma of the breast She underwent lumpectomy followed by adjuvant chemotherapy and radiotherapy Since then ... liquid culture gave a positive signal after days of incubation The presence of Mycobacterium tuberculosis was verified by AccuProbe assay (Gen-Probe, CA) and phenotypic-biochemical analysis Since...
- 4
- 352
- 0
báo cáo khoa học: "Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients" pot
... of cancer are increased when pre-diagnostic CRP levels are high [7] Cancer invasion begins with inflammation around cancer cells Thus, it has been reported that serum CRP levels are higher in cases ... 38:597-602 Polterauer S, Grimm C, Tempfer C, Sliutz G, Speiser P, Reinthaller A, Hefler LA: C- reactive protein is a prognostic parameter in patients with cervical cancer Gynecol Oncol 2007, 107:114-117 ... JL: Confirmation of a prognostic index in primary breast cancer Br J Cancer 1987, 56:489-492 14 Lonn U, Lonn S, Nilsson B, Stenkvist B: Breast cancer: prognostic significance of c- erb-B2 and int-2...
- 6
- 279
- 0
Báo cáo khoa học: "Ductal carcinoma in situ and sentinel lymph node metastasis in breast cancer" potx
... intradermally in the peri-tumoral space just before surgery Histopathological procedures Surgical materials from breast- conserving surgery were sectioned at 0.5 cm intervals, and each section was examined ... Helbich TH, Jakesz R, Gnant M: Preoperative core needle biopsy does not increase local recurrence rate in breast cancer patients Breast Cancer Res Treat 2006, 97:9-15 Peters-Engl C, Konstantiniuk ... follows: curative surgical treatment, performance of sentinel lymph node biopsy, and no primary chemotherapy Patients with metachronous ipsilateral breast cancer were excluded Furthermore, we...
- 5
- 330
- 0
Báo cáo khoa học: "Postmastectomy locoregional recurrence and recurrence-free survival in breast cancer patients" pdf
... 55(1):10-30 American Cancer Society: Cancer Facts & Figures 2004 Atlanta, GA, American Cancer Society; 2004 Cady B, Stone MD, Schuler JG, Thakur R, Wanner MA, Lavin PT: The new era in breast cancer Invasion, ... Montgomery S: Cancer statistics, 1994 CA Cancer J Clin 1994, 44(1):7-26 Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ, Thun MJ: Cancer statistics, 2005 CA Cancer J Clin 2005, ... rate in 276 patients included in Danish Breast Cancer Cooperative Group (DBCG) 82b and 8 2c trials was found to be 27% [10] In the present study, most recurrence of breast cancer occurred within...
- 7
- 401
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008