3mouse model based evidence that nf kappa b plays a pro oncogenic role in hcc

Báo cáo y học: " Cellular receptor binding and entry of human papillomavirus" pdf

... involved in HPV binding And it has been clarified that a6 integrin played a leading role in this process with the evidence that a monoclonal antibody against the a6 integrin subunit reduced the binding ... Tetraspanins are an evolutionary conserved family of four transmembrane domain-containing proteins including at least 32 members in humans [41], which are able to interact laterally with each ... Heparan sulfate proteoglycans/Heparan sulfate 1.2.1 Heparan sulfate proteoglycans/Heparan sulfate and HPV binding Cell surface heparan sulfate proteoglycans (HSPGs), mainly syndecans and glypicans,...

Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc

Danh mục: Báo cáo khoa học

... concentrations Primary antibodies including mouse monoclonal NF- jB p65, rabbit polyclonal NF- jB p65, goat and rabbit polyclonal NF- jB p50, and rabbit polyclonal p47phox were obtained from Santa Cruz Biotechnology ... messengers that regulate intracellular signaling cascades and transcription factors Some investigations have reported that NF- jB can be activated by ROS [32,33] produced by a pathway involving 5-LOX ... IL- 1b and IL-6 that is blocked by the NF- jB inhibitor (PDTC or SN-50) Moreover, the NF- jB binding ability is abrogated by binding site competition and antibody supershift analysis These ﬁndings indicate...

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Danh mục: Báo cáo khoa học

... atoms ˚ Average main chain B- factor (A2 ) ˚ Average side chain B- factor (A2 ) ˚ Average ligand B- factor (A2 ) BGC 1a ˚ Average ligand B- factor (A2 ) BGC 2b ˚ Average ligand B- factor (A2 ) L3-1c ˚ Average ... cell wall Surfacebased carbohydrate binding sites of weak afﬁnity are well known (e.g in lectins and haemagglutinin) where Carbohydrate binding sites in Candida exoglucanase shallow indentations ... apparently in a position to interact with the b- 1,3-glucan substrate Strikingly, the carbohydrate-binding module CBM 4-2 of a bacterial laminarinase, which recognizes the same substrate (laminarin)...

Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

Danh mục: Báo cáo khoa học

... approach gives good evidence for a ligand-binding activity of CF-produced ETB 3262 Fig Ligand binding of ETB derivatives Binding of ETB derivatives to bET-1 was analyzed by pull-down assays Bound ... determinant for ET-1 binding On the basis of chimeric ETB derivatives and binding of antagonists, Wada et al proposed a 60 amino acid area spanning I138-I197, and thus covering TMS2 and TMS3, as ... straightforward, and puriﬁed ETB protein in sufﬁcient amounts for structural analysis can now be obtained in less than days It should also be mentioned that the production of labeled membrane proteins,...

Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Danh mục: Báo cáo khoa học

... stand-alone A- domain that activates b- lysine by adenylation It was also found that S noursei harbours a protein that after activation speci®cally binds b- lysine as a thioester This protein contains ... that the active site of the enzyme can strictly distinguish between an a- amino and a b- amino group of lysine Other b- amino acids such as b- alanine or b- aminobutyric acid, c-aminobutyric acid and ... poly (b- lysine) chain of nourseothricin must be synthesized by an NRPS-like system in a mechanism that uses NspA, a stand-alone b- lysine adenylating enzyme (A- domain) and NspB, a b- lysine binding protein...

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-speciﬁc Rnf33⁄Trim60 gene pot

Danh mục: Báo cáo khoa học

... Kowalik TF, Schmid RM, Huang ES, Baldwin AS Jr & Nabel GJ (1993) Dimerization of NF- KB2 with RelA(p65) regulates DNA binding, transcriptional activation, and inhibition by an I kappa B- alpha (MAD-3) ... heterodimer or by p65 alone, but not by p50 alone [16,17,29] Signaling pathways that activate NF- jB have been well documented [13–15] In the canonical NF- jB activation pathway, degradation of IjBa through ... modulated by the NF- jB subunits p65 and p50, and also by TNF -a Although p65 is probably expressed in the oocyte and the pre-implantation embryo, it remains to be shown if the TNF -a ⁄ NF- jB signaling...

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Danh mục: Báo cáo khoa học

... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley ... 128146 Plant Plant Plant Plant Plant Plant Mammal Bacterium Mold Yeast Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium ... conserved in plant a- amylases, has a role in substrate binding and activity This local region was different in structures of nonplant a- amylases having a longer ba loop which typically contained aromatic...

Báo cáo y học: "The S100A8/A9 heterodimer amplifies proinflammatory cytokine production by macrophages via activation of nuclear factor kappa B and p38 mitogen-activated protein kinase in rheumatoid arthritis" potx

Danh mục: Báo cáo khoa học

... (mitogenactivated/extracellular signal-regulated kinase) inhibitor PD98059, as well as by SB202474 tion independence of p38 mitogen-activated protein kinase (MAPK) activaS10 0A8 /A9 -induced nuclear factor kappa B (NF- B) ... S10 0B and S10 0A1 2 to RAGE [1] suggest that RAGE may be a general receptor for the S100 family of proteins The inflamed synovial membrane in patients with RA is characterized by infiltration of inflammatory ... 105:2955-2962 42 Kawanaka N, Yamamura M, Aita T, Morita Y, Okamoto A, Kawashima M, Iwahashi M, Ueno A, Ohmoto Y, Makino H: CD14+, CD16+ blood monocytes and joint inflammation in rheumatoid arthritis Arthritis...

Báo cáo y học: " Nontypeable Haemophilus influenzae induces COX-2 and PGE2 expression in lung epithelial cells via activation of p38 MAPK and NF-kappa B" pps

Danh mục: Báo cáo khoa học

... NTHi-induced NF- kappa B signaling pathway EMSA analysis showed that NFkappa B translocation and its DNA binding activity were markedly increased by NTHi within 90 mins, and DNA binding activity ... there are still increasing evidences that the blockade of MAPK inhibited NF- kappa B- dependent gene transcription without affecting IkappaBalpha phosphorylation and NF- kappa B- DNA binding ability ... expression in human airway myocytes via separate signaling pathways given the fact that SB203580 did not affect cytokine-stimulated IkappaBalpha degradation and NF- kappa B nuclear binding activity...

Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx

Danh mục: Báo cáo khoa học

... CXCL10-induced RANKL expression, we used PTX, a bacterial toxin that inhibits Gai activation by ADP-ribosylating Gai subunits, and the inhibition of Gai by PTX was confirmed by measuring CREB phosphorylation ... inflamed tissues and in the perpetuation of inflammation and thus may contribute importantly to tissue damage RA is a chronic inflammatory arthritis and is characterized by joint inflammation, ... MO, USA) The nitrocellulose membrane was subsequently washed and incubated with a peroxidase-labeled rabbit anti-goat IgG antibody for hours at room temperature and then incubated with an enhanced...

Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"

Danh mục: Y học thưởng thức

... of all variables analysed Each subsequent component constitutes an independent linear combination of variables, capturing a maximum of the variance remaining in the data set, and is orthogonal ... yielding the variable loadings shown in variable loading plots The first principal component has the capacity to encompass a maximum of the variance in one single vector, which is a linear combination ... concentration in plasma that had been stored at –70ºC was measured by a sandwich ELISA (Mercodia, Uppsala, Sweden) utilizing the same specific murine monoclonal antibody, mAb-4E6, as in the assay...

Data Binding and Silverlight List Controls

Danh mục: Kỹ thuật lập trình

... to add a class to define a Book object Below the MainPage class, add the following class definition: namespace BasicDataBinding { public partial class MainPage : UserControl { public MainPage() ... elements Also, by using data binding, you are able to separate the UI from the data in your application, which allows for a cleaner UI and easier maintenance The Binding Class Data binding in Silverlight ... ...

Tài liệu Carrier-Class CATV Networks Maintaining Signal Connectivity During Configuration Changes and Maintenance docx

Danh mục: Phần cứng

... into racks, cabling concerns became paramount Rack-mounted combining networks (see Figure 3) were designed to ease the sudden onslaught of cables By maintaining all cabling within the rack lineup ... including emergencies Service availability is critical Page Carrier-Class CATV Networks: Maintaining Signal Connectivity During Configuration Changes and Maintenance Reconfiguration with Minimal ... confinements within the rack, configurations and troubleshooting remained extremely difficult Carrier-Class CATV Networks: Maintaining Signal Connectivity During Configuration Changes and Maintenance...

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efﬁcacy pdf

Danh mục: Báo cáo khoa học

... believe that reduced TRBP binding is a probable reason for reduced silencing by mismatched siRNAs That said, it appears that Dicer binding can have an impact on the silencing efﬁciency of some siRNAs ... with EGFP-targeting siRNAs and either a non-targeting (NT) siRNA (white bars), a TRBP-targeting siRNA (A, gray bars) or Dicertargeting siRNA (B, black bars) Total ﬁnal siRNA concentrations were ... As with one terminal mismatch, binding by Dicer was improved for simultaneous single mismatches but reduced for double mismatches In all cases, terminal mismatches reduced TRBP binding, as above...

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine ﬁbrosarcoma L929 cells doc

Danh mục: Báo cáo khoa học

... or NF- jBp65 siRNA As shown in Fig 1 1A ,B, PDTC or p65 siRNA signiﬁcantly reduced oridonin-induced autophagy, and oridonin-induced Beclin activation was inhibited by p65 siRNA, indicating that NF- jB ... apoptosis and ROS accumulation The transcription factor NF- jB mainly mediates cell survival signaling pathway In the present study, we found that inhibition of NF- jB activation by using NF- jB inhibitor ... demonstrate that NF- jB promoted oridonin-induced autophagy and that oridonin-induced p38 might contribute to NF- jB activation Discussion Intracellular ROS generation plays an important role in numerous...

Tài liệu Báo cáo khoa học:Insulin-like growth factor 1 signaling regulates cytosolic sialidase Neu2 expression during myoblast differentiation and hypertrophy doc

Danh mục: Báo cáo khoa học

... (1998) Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling pathway Proc Natl Acad Sci USA 95, 7772–7777 12 Nave ... transfectants was obtained after 10 days of selection in puromycin antibiotic (2 lgÆmL)1, Sigma) and used for a few passages RNA extraction and RT-PCR analysis Total RNA was obtained by Tri-reagent ... a pBABE vector in which a myristoylated AKT or a kinase-inactive AKT mutated at the ATP-binding site (K179M) were cloned [13] After transfection by Lipofectamine 2000 reagent, the mix of stable...

Tài liệu Age-related changes of the dental aesthetic zone at rest and during spontaneous smiling and speech pptx

Danh mục: Chụp ảnh - Quay phim

... Gosain A K, Amarante M T, Hyde J S, Yousif N J 1996 A dynamic analysis of changes in the nasolabial fold using magnetic resonance imaging: implications for facial rejuvenation and facial animation ... smiling and speech records, the display of teeth and gingiva was measured In the maxilla and mandible, a central and lateral incisor, a canine, a first and second premolar, and a first molar were measured ... An interesting finding was that the age-related decrease in lip line height during spontaneous smiling was considerably less than in the natural rest position It was also interesting to note that...

Tài liệu Báo cáo khoa học: Tet repressor mutants with altered effector binding and allostery docx

Danh mục: Báo cáo khoa học

... containing no palindromic sequence was used as a negative control (5¢-ctaataaaattaatcatttatggcataggcaacaag-3¢) All samples were incubated in complex buffer containing 0.02 m Tris ⁄ HCl (pH 8.0) and ... binding function and including cooperative binding Electrophoretic mobility shift assay The synthetic tetO1 containing fragment 5¢-gggtgtgcc gacactctatcattgatagagttattatac-3¢ and tetO2 containing ... location-function relationships, the data presented here establish that alterations of residues in that interface built by helices a1 , a4 and a6 (Fig 1A) also affect both substrate FEBS Journal...

Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf

Danh mục: Báo cáo khoa học

... GTCACATCATGCGCCACTTTG TTGTAGCCATCGGGAACCTTGTAG GGCCACCACAATCAAATGTCAC CTCCTCGTGCTTCCCCTCTACC GAGATCATCAAGCCCACCACAAC CGGGAAACTTAATGTCGAAGGAGAC ACATCTCGCCGTACTTCATCAACTC GGAGGAGGGCATCTTGGAACTC ... TGGATGAACCCACACCCAATC CGAGGCAACGGGCACTTC GAAGGCACTCAAGGACGCTAAAATG CTGAACCTTGGGAATACGAGTG TCGATGGTACTGACCAAGATGAAGG GAGTCGTTGAAGTAGGCTGGAACTG TGCTGGATGTCACTCCTCTGTCTC TGGGTATGGTGGTGTTCCTCTTAATC ... RA a a a a a a a a a a a b b b b b a a b b a b b b b b b a a b b a b FEBS Journal 277 (2010) 174185 ê 2009 The Authors Journal compilation ê 2009 FEBS H Colinet et al Other Hsp genes The mRNA...

Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot

Danh mục: Báo cáo khoa học

... 12 base RNA (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 ... degÆcm)2Ædmol)1, was calculated by using an average amino acid molecular weight of 110 Binding analysis to substrate Binding of proteins to the substrate was analyzed using the Biacore X instrument (Biacore, ... as a template The sequences of the PCR primers are 5¢- TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢...

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008