3 the substantial rural health delivery gap could be bridged with a robust community health worker oriented strategy
báo cáo khoa học: " A win-win solution?: A critical analysis of tiered pricing to improve access to medicines in developing countries" pptx
... (PI), atazanavir (ATV), which must be taken together with ritonavir but is not yet available as an FDC with ritonavir [21] Since 2006, LPV/r has been available in a heat-stable formulation that ... to treat fungal infections, as well as visceral leishmaniasis (VL; kala azar), a fatal neglected tropical disease highly endemic in India, Bangladesh, Nepal, Sudan, Ethiopia, and Brazil Amphotericin ... prices in the long term Malaria: Artemisinin-based Combination Therapies As with ARVs, evidence from the market for artemisinin-based combination therapy (ACT) drugs for malaria shows that generic...
- 11
- 402
- 0
Herbal Antibiotics Natural Alternatives for Treating Drug-Resistant Bacteria doc
... many parts of Africa, primarily along the western coast; the root may be harvested at any time of year Actions: Antiparasitic, antimalarial, antibacterial, antifungal Active against: Malaria, ... nilotica, is specific for malaria in Nigeria; and another, A polyacantha, is specific for malaria in Tanzania They share a common use throughout the world for amebic dysentery Acacias, or mimosas as ... julifera, P pubescens), a relative and similar-appearing plant with a much broader range in the southwest, may be used identically: same preparation, same dosage, same results Aloe (Aloe Vera and Other...
- 180
- 557
- 0
Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"
... performed a prospective study of ten patients (8 male and female) with an age range of 35 - 73 years All patients presented with mid-thoracic axial (n=7) or radicular (n=1) pain that failed to improve with ... recreation of symptoms with palpation The pain was either centralized or radiating to one side There was no facet tenderness present All the patients had negative facet injections, to evaluate ... “cooled” with normal saline (at least 100 ml) mixed with cefazolin (unless there was an allergy) Saline irrigation was performed after, not simultaneously with, laser application due to the size of the...
- 5
- 593
- 0
Advances in StentTherapy for Ischaemic Heart Disease
... EPC antibodies Biorest Advanced coatings Many agents have multiple actions SIRIUS Analysis 3- year Clinical Outcome Sirolimus (n= 533 ) Death All myocardial infarction Q-wave Non-Q-wave TLR (all) ... Heart Mechanisms of Late Stent Thrombosis Across major branch High power view Mak Heart Farb A et al Circulation 20 03 Mechanisms of Late Stent Thrombosis Radiation Necrotic core Mak Heart Farb ... Endeavor II No late stent thrombosis in the either stent arm Discharge – 30 Days In-Hospital 31 days – 180 Days 181 – 284 Days 30 Days Endeavor 0 .3 Stent 0.2 (n=582) Months No Late Thrombosis (Late...
- 38
- 375
- 0
Tài liệu Báo cáo khoa học: Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters docx
... The research was supported in part by the National Institutes of Health grant GM062920 We thank the staff at SER-CAT beamline at the Advanced Photon Source, Argonne National Laboratory, Argonne, ... interaction with the carboxylate group in the minor conformation of Asp30 The water interaction with the amide of Ile50¢ was weakened (dis˚ tance of 3. 5 A) The C-HÆÆÆO interaction between the carbonyl ... side chains of Asp30 and Asp30¢ accommodate diverse functional groups at P2 and P2¢ of SQV and APV at the surface of the PR active site cavity The functional group can be critical for a tight...
- 16
- 582
- 0
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... Pacific and the Americas A substantial number of people travelling to endemic regions are also infected each year In the last year, DHF has again been on the increase in India and in several Asian ... protein with an N-terminal protease domain (NS3pro) (1–180), an RNA triphosphatase, an RNA helicase and an RNAstimulated NTPase domain in the C-terminal region [26,27] The protease and NTPase enzymatic ... nascent RNA strands from the template [30 ] The NS3 viral protease is absolutely essential (along with the viral-encoded cofactor NS2B) for viral replication In addition to the cleavages at the protein...
- 17
- 462
- 0
Tài liệu EXTERNAL SYMPTOMS FOR DIAGNOSING POULTRY DISEASES ppt
... aspergillosis; Arizona paracolon; paratyphoid Laryngotracheitis; ammonia burn; Newcastle disease; nutritional deficiency-vitamin A Epidemic tremor Nutritional deficiency-vitamin A; fowl pox Marek's disease ... Pale Possible Cause Poor production; high pigment intake Marek's disease Flukes (rare) Necrotic dermatitis, exudative diathesis Erysipelas; fowl cholera Erysipelas; scab; gangrenous dermatitis ... Pustules Crusts at margins Beak soft, rubbery Possible Cause Nutritional deficiency-vitamin A Nutritional deficiencies-pantothenic acid or biotin Nutritional deficiencies-vitamin D or calcium-phosphorus...
- 5
- 450
- 0
Tài liệu Báo cáo Y học: Receptor crosstalk Implications for cardiovascular function, disease and therapy ppt
... AC-mediated cAMP synthesis [1,2] AC-mediated cAMP synthesis [2,55] AC inhibition [2,87] ADO A1 A2 A A2 B A3 Brain, heart Pacemaker VSM, brain Heart, kidney Bradycardia Vasodilatation VSM relaxation ... messages at the appropriate time, using sympathetic and parasympathetic routes as links between the extracardiac and the cardiac signals Implication of receptor crosstalk for cardiovascular physiology ... b1-AR and OPRs [29] as well as the AT1R and ANP systems [32 ], although a Gi-mediated crosstalk bypassing PLC stimulation has also been proposed between b-AR and OPRs [30 ] The same pathway has been...
- 18
- 621
- 0
For Chronic Kidney Disease: Evaluation, Classification and Stratification doc
... 30 31 32 33 34 Table 35 Table 36 Table Table Table Table 37 38 39 40 Table 41 Table 42 Table 43 Table 44 Table 45 Table 46 Table 47 Proteinuria: Prevalence in Nondiabetic Children 54 Albuminuria: ... 29 30 31 32 33 34 35 36 37 38 Level of GFR at Initiation of Replacement Therapy (USRDS) . 63 Relationship of Creatinine Clearance and Serum Creatinine With GFR (Inulin Clearance) in Patients With ... Foundation xv A CRONYMS AND ABBREVIATIONS AASK ABPM ACE-inhibitor ADA AFT Alb ASCVD ASN AST ASTP AV BAP BDI BEE BMI BP BPI BSA BUN CAD CCD CCr CDI CES-D CG equation K/DOQI African American Study...
- 356
- 600
- 1
FACING THE REALITY OF DRUG-RESISTANT TUBERCULOSIS: CHALLENGES AND POTENTIAL SOLUTIONS IN INDIA pot
... ANA RY A RUNA L PR DES CHA A H SI K K IM Ag Ja ipur JALMA BI A H R Luc know J HARKHAD N MADHY PR DES A A H Ah medabad Ja mnagar Nagpur MAHA HT RAS RA Ra ipur Hyderabad MIZOR AM OR A ISS Cuttack ... Vizag BP , Hyd RC GO A K RNATK A AA TR IPUR A WE T B NGA S E L NA LA GA ND Imphal CH TISGA H HA R Wardha MC Mumbai JJ P DHH Pune Ra nchi AS M SA Ko lkata Indore Manipal Gu wahati ME GHALAYA Patna ... GHALAYA Patna Ja balpur GU A JAR T Itanagar Ga ngtok UT TARPR DES A H Aj er m Jo dhpur AIIMS LRS DE LHI Gurgaon RA S N JA THA NDTC Tanda MC Dharampur CHD Dehradun Ka rnal UT TARA KHAN D TA NADU MIL...
- 147
- 375
- 0
Medicines for Reproductive Health: Ensuring Access to Quality Assured Products potx
... multinational pharmaceutical companies based in OECD countries Adopting an innovative and mutually beneficial strategy, donors and international agencies purchased and delivered specially adapted ... live in the USA and Europe and, in general, have unrivalled access to health care, they (or 11 Hall PE (2005) What has been achieved, what have been the constraints and what are the future priorities ... assurance that international norms and standards are applied at all the steps of the prequalification and within the process itself; and enabling access to good quality medicines Prequalification...
- 28
- 395
- 0
INFLUENZA VIRUS a model for learning about disease
... contain dsDNA Often make the bacteria they infect more pathogenic for humans T-even Phages Icosahedral capsid head containing DNA Central tube surrounded by a sheath Collar Base ... Ivanovski and Beijerinck showed that a disease in tobacco was caused by a virus Loeffler and Frosch discovered an animal virus that causes foot –and-mouth disease in cattle Many years of ... plate Tail pins Fibers Similar stages as animal viruses Adsorb to host bacteria The nucleic acid penetrates the host after being injected through a rigid tube inserted through the bacterial...
- 59
- 1,519
- 0
Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx
... TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC GGCCTTCACAGCTTTGTCAACATCTGCCTTGTCCCCTTCTTCCACATGGC ... GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC ... Adh4 (class IV Adh) Aldh1 (class I Aldh) – Mouse Rat Rat Mouse Rat Mouse Rat Rat Rat Rat ⁄ mouse Rat ⁄ mouse ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT...
- 12
- 504
- 0
Managing drug resistant tuberculosis ppt
... tuberculosis and the public health department was notified The patient was next seen five months later, after returning from a trip to the Caribbean He said he had been taking antituberculosis medication ... observed therapy for treating tuberculosis Cochrane Database Syst Rev 2007; (3) :CD0 033 43 Taylor Z, Nolan CM, Blumberg HM Controlling tuberculosis in the United States Recommendations from the American ... while away, but his sputum was again smear positive An HIV test was negative After a brief stay in hospital he agreed to have directly observed treatment, and ethambutol was added in view of the...
- 6
- 95
- 0
Radiological Findings of Extensively Drug-Resistant Pulmonary Tuberculosis in Non-AIDS Adults: Comparisons with Findings of Multidrug-Resistant and Drug-Sensitive Tuberculosis docx
... in Table The mean age of all patients was 47 years and the age range was 15-85 years The mean ages were significantly different for the DS TB group (mean age, 51 years; median age, 53 years; age ... in the study Among the 17 patients, a chest radiograph was available for 15 patients and CT scans were available for seven patients Imaging studies were obtained within 60 days of the expectoration ... Consolidation was defined as a homogeneous increase in pulmonary parenchymal opacity that obscured the margins of vessels and airway walls GGO was defined as an area of hazy increased lung opacity, within...
- 10
- 460
- 0
Safe and Effective Medicines for Children: Studies Conducted Under the Best Pharmaceuticals for Children Act and the Pediatric Research Equity Act potx
... Michael Hayes and Debra Gilliam, Chanda Chay, and John Bowers at Caset Associates Within the National Academies, we acknowledge the assistance of Adam Berger, Laura Harbold, Donna Randall, Vilija ... and Acronyms AAP ACR ADHD AERS AHA AHRQ BLA BPCA BPCIA CBER CDC CDER CDRH CNS COG CYP DESI DMC DSI EMA EU FDA FDAAA FDAMA FDC Act FEV1 FOIA GCP GERD HHS IBD IGIV American Academy of Pediatrics American ... pediatricians, researchers, and advocates A number of speakers at these meetings, including Anne Zajicek, Natella Y Rakhmanina, Samuel Maldonado, and Ronald Portman, also shared their knowledge at other times...
- 351
- 420
- 0
Báo cáo khoa học: Amyloid–cholinesterase interactions Implications for Alzheimer’s disease pot
... that could have a really therapeutic potential in this area Acetylcholinesterase’s ability to increase the amyloid aggregation depends of the amyloidogenic properties of the Ab peptide A number ... (human recombinant enzyme) was aggregated at 37 °C without stirring A lL aliquot was obtained at h incubation, stained with 2% uranyl acetate and photographed with an electron microscope More Ab ... acetylcholinesterase in Alzheimer’s disease: abnormal localization and solubilization J Neural Transm Suppl 30 , 13 23 Kalaria RN, Kroon SN, Grahovac I & Perry G (1992) Acetylcholinesterase and its association...
- 8
- 254
- 0
Addressing the Threat of Drug-Resistant Tuberculosis potx
... Genentech, California Leslie Z Benet, University of California, San Francisco Catherine Bonuccelli, AstraZeneca Pharmaceuticals, Delaware Linda Brady, National Institute of Mental Health, Maryland Robert ... in Africa Lack of Data Yanis Ben Amor of the Earth Institute argued that the WHO data severely underestimate the problem of MDR TB in Africa He stressed that WHO’s claim that rates in Africa are ... October 2008) are available for many locations, Figure 2-1 in sub-Saharan Africa Secparticularly ond, in many countries, the availability of diagnostic laboratories is limited; R01 436 nine African...
- 253
- 296
- 0
Guideline for Alzheimer’s Disease Management pdf
... hyperactive (agitated) behaviors, psychosis, affective behaviors and apathy (Aalten et al., 2007) Agitation and aggression have been shown to be associated with pain in patients with dementia (Howard ... decision-making capacity at the initial assessment and should ask the patient and family whether a surrogate decision-maker has been identified by the patient The patient who has the capacity to ... after an additional weeks Nausea, vomiting, and diarrhea (must be taken with food) More nausea and vomiting than with other ChEIs Anorexia Maybe less muscle cramping than with other ChEIs-Bradycardia...
- 122
- 277
- 0
Delamanid for Multidrug-Resistant Pulmonary Tuberculosis pdf
... events and clinically significant abnormal laboratory results were evaluated as appropriate Statistical Analysis Safety evaluations were performed in all patients who underwent randomization and ... 19.5 19.5 19.6 Range 12 31 12–40 12 31 12–40 Region — no (%)‡ Americas 39 (27.7) 38 (27.9) 39 (31 .2) 116 (28.9) Southeast Asia 43 (30 .5) 47 (34 .6) 45 (36 .0) 135 (33 .6) Northeast Asia 29 (20.6) 28 ... by the authors are available with the full text of this article at NEJM.org We thank the members of the data and safety monitoring committee — Drs Charles Daley, Thomas Fleming, Martin Keane, and...
- 10
- 420
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25