3 notice of deposition of a nonparty witness and proof of service by mail

Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx

Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx

Ngày tải lên : 21/06/2014, 03:20
... compare categorical data A mixed models analysis was employed using SAS Systems A repeated-measures ANOVA was used, where the year was regarded as the repeated measure and the factor was the variable ... aspects of obstetric and neonatal service was adopted In 2006, EMS introduced a dedicated maternal and neonatal Flying Squad service to address some of these failings The purpose of the programme was ... before dispatching them It is suggested that in the case of neonatal and maternity incidents, the fact that these patients are already accommodated at a health facility has led many dispatchers...
  • 6
  • 432
  • 0
Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx

Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx

Ngày tải lên : 21/06/2014, 04:20
... protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evaporation on a glass substrate (0.8 × 7.0 cm) in a vacuum at a temperature of 65°C ... et al Nanoscale Research Letters 2011, 6 :33 6 http://www.nanoscalereslett.com/content/6/1 /33 6 Page of nanoisland was nearly saturated with SOD1 protein That is, the operational amplitude of absorption ... gold nanoisland The thickness of the gold nanoisland and the ratio of heteroligand were optimized so as to maximize the sensitivity of the method The area of MPA was locally activated to reactive...
  • 7
  • 432
  • 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Ngày tải lên : 18/02/2014, 08:20
... carcinoma cells Oncogene 20, 2499–25 13 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity ... Unphosphorylated STAT3-dependent activation of NF-jB has also been reported [35 ], although our data indicate that the hairpin ODN blocks activated STAT3 and may not inhibit unphosphorylated STAT3 Preparation...
  • 11
  • 558
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe ... reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC -3 and its complement for His6Ala; 5¢-GACATCCATAGTGCT...
  • 14
  • 601
  • 0
Tài liệu A General History and Collection of Voyages and Travels, Vol.3 ppt

Tài liệu A General History and Collection of Voyages and Travels, Vol.3 ppt

Ngày tải lên : 21/02/2014, 11:20
... Galicia, Majorca, Minorca, Seville, Sardinia, Jaen, Algarve, Algezira, Gibraltar, and the Canary islands, Lord and Lady of Biscay and Molina, Duke and Duchess of Athens and Neopatria, Count and ... Fernandina While sailing between the island of Conception and Fernandina they found a man paddling along in a small canoe, who had with him a piece of their bread, a calabash full of water, a small ... use and exercise in the said ocean the office of admiral in all things, and in the same manner and form, and with the rights and privileges, perquisites and salaries as our admirals of Castile and...
  • 261
  • 461
  • 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Ngày tải lên : 08/03/2014, 08:20
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC -3 ; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... cytoskeleton and translational apparatus J Cell Sci 111, 1 83 197 12 Szabo, A. , Dalmau, J., Manley, G et al (1992) HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is ... 3T3 cells were harvested and extracts separated into nuclear and cytoplasmic fraction by centrifugation (see Materials and methods) Twenty micrograms of each fraction were loaded per lane on a...
  • 16
  • 754
  • 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Ngày tải lên : 17/03/2014, 10:20
... (F) 4.66 3. 32 3. 50 3. 40 3. 43 4.08 3. 96 3. 93 3. 83 Polymer III 3. 90 3. 72 * or 2); CH3CON, d1. 93 and 2.07 chromatography [25] The absolute configuration of ManpNAc3NAcA(D-) in the polymer I was inferred ... Involvement of bacterial polysaccharides in plant pathogens Ann Rev Phytopathol 33 , 1 73 197 31 Reuhs, B.L., Kim, J.S & Matthysse, A. G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis ... H-5 3. 36 3. 58 4.40 4 .33 3. 40 3. 69 3. 93 4. 03 3.98 3. 88 3. 95 3. 55 4.01 3. 80 3. 66 H-5¢ H-6 H-6¢ H-7 H-8 H-9 H-9¢ Polymer II (C) 1.78 2.20 (D) 4.55 3. 31 3. 50 3. 38 3. 39 (E) 4.09 3. 97 3. 96 3. 81 4.18...
  • 6
  • 561
  • 0
Annex A.3 Review of Tuberculosis Infection Control ppt

Annex A.3 Review of Tuberculosis Infection Control ppt

Ngày tải lên : 22/03/2014, 18:20
... undiagnosed, untreated, and potentially infectious (contagious) TB are often seen in HIV care settings Health care workers and other staff at HIV care facilities are at particularly high risk of ... disease, who are not receiving adequate treatment, and who have not been isolated from others The main goal of an infection control program is to detect TB disease early and to promptly isolate and ... disease •Placing these patients in an area away from other patients •Instructing them in cough hygiene •Making sure they get a diagnostic evaluation, and then treatment if they have TB disease Patients...
  • 51
  • 581
  • 0
NOTICE OF INTENTION TO REMOVE AND PROHIBIT AND NOTICE OF CHARGES AND HEARING AND NOTICE OF ASSESSMENT OF A CIVIL MONEY PENALTY pptx

NOTICE OF INTENTION TO REMOVE AND PROHIBIT AND NOTICE OF CHARGES AND HEARING AND NOTICE OF ASSESSMENT OF A CIVIL MONEY PENALTY pptx

Ngày tải lên : 29/03/2014, 09:20
... unilateral, and unnegotiated modifications of his Restated Guaranty, and by concealing the modifications, Respondent effectuated a scheme to release himself of any personal liability as a guarantor ... he made to his Restated Guaranty, and informed ESSA that he would not make any payment on the defaulted Loans because his Restated Guaranty, as modified, released him as a guarantor of the Loans ... institution's actions on a loan; and b Respondent violated 18 U S.C § 134 4 by knowingly making material misrepresentations and/ or concealing material facts as part of a scheme or attempted scheme to defraud...
  • 11
  • 309
  • 0
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx

báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx

Ngày tải lên : 20/06/2014, 00:20
... (Sigma, St Louis, MO, USA), 0 .3% collagenase (Worthington, Freehold, NJ), and 0.1% type I testicular hyaluronidase (Sigma) After an incubation of 30 at 37 °C and 5% CO2, the media was replaced and ... and maximally stretched state at each power setting in 16-bit gray-scale at 16× magnification using a Polaroid DMC2 digital microscope camera (Polaroid, Wayland, MA, USA) connected to a Leica ... Research 2000, 18:899-908 Sah RL, Grodzinsky AJ, Plaas AHK, Sandy JD: Effects of static and dynamic compression on matrix metabolism in cartilage explants In Articular Cartilage and Osteoarthritis...
  • 10
  • 546
  • 0
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx

Ngày tải lên : 10/08/2014, 05:21
... Cry41Aa (parasporin -3) and Cry45Aa (parasporin-4) also with selective cytotoxic activities against cancer cells [5-7] Recently two more parasporin (PS5Aa1 and PS6Aa1) were added in the parasporin ... lines [Abstract] MJMS 2007, 14(1 supp):2 15 Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin-2, ... proteins of a Bacillus thuringiensis isolate against human cells, including cancer cells J Appl Microbiol 2000, 89:16- 23 Katayama H, Yokota H, Akao T, Nakamura O, Ohba M, Mekada E, Mizuki E: Parasporin-1,...
  • 11
  • 366
  • 0
Báo cáo y học: "Expression of tumor necrosis factor-alpha converting enzyme and matrix metalloproteinase-3 in proliferated synovium in a patient with synovitis-acne-pustulosis-hyperostosis-osteitis syndrome: a case report" doc

Báo cáo y học: "Expression of tumor necrosis factor-alpha converting enzyme and matrix metalloproteinase-3 in proliferated synovium in a patient with synovitis-acne-pustulosis-hyperostosis-osteitis syndrome: a case report" doc

Ngày tải lên : 11/08/2014, 14:21
... evaluated laboratory and imaging data, and assisted with manuscript editing MS and SK collected the patient’s information YM was the pathologist and performed the histological examinations All ... expression of TACE, TNF -a and MMP -3 in SAPHO syndrome synovitis for the first time and also show the similarity between SAPHO syndrome and RA synovitis Case presentation A 53- year-old Japanese woman ... of reports with detailed histopathological analyses of SAPHO syndrome synovitis, the similarity of the histopathological features between SAPHO syndrome and RA indicates that, at least partially,...
  • 4
  • 329
  • 0
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc

Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc

Ngày tải lên : 11/08/2014, 16:20
... month -3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed Apart from ... concomitant disease and practically all laboratory parameters than any other Prev-AP cohort, but had a comparatively higher symptom severity at baseline (mean CGI-S 4.2) Table Prevalence of metabolic ... http://www.biomedcentral.com/1471-244X/11/1 73 29 30 31 32 33 34 35 36 37 38 Page 11 of 11 (CATIE) schizophrenia trial and comparison with national estimates from NHANES III Schizophr Res 2005, 80(1):19 -32 Gesundheitsberichterstattung...
  • 11
  • 425
  • 0
Báo cáo y học: " Laypersons can successfully place supraglottic airways with 3 minutes of training. A comparison of four different devices in the manikin." docx

Báo cáo y học: " Laypersons can successfully place supraglottic airways with 3 minutes of training. A comparison of four different devices in the manikin." docx

Ngày tải lên : 13/08/2014, 23:20
... insertion by the naùve intubator Br J Anaesth 2000;84:1 031 05 Choyce A, Avidan MS, Shariff A, Del Aguila M, Radcliffe JJ, Chan T A comparison of the intubating and standard laryngeal mask airways for airway ... malleability of the oral and supraglottic tissue of the Ambu Airway Manđ, we show that all four supraglottic airway devices applied by laymen provided a reasonable airway and allowed for the application ... setting and participants RR approved the final version and NZ co-conceived, critical revised the manuscript and allocated data All authors read and approved the final manuscript 13 References: Handley...
  • 23
  • 417
  • 0
Báo cáo y học: "A catalog of stability-associated sequence elements in 3'''' UTRs of yeast mRNAs" ppt

Báo cáo y học: "A catalog of stability-associated sequence elements in 3'''' UTRs of yeast mRNAs" ppt

Ngày tải lên : 14/08/2014, 14:22
... a catalog of 53 stability-associated motifs and a catalog of 23 subcellular localization motifs Although in the derivation of the motifs only half-life and localization data were used, many of ... regulated by a stability and a de-stability motif Decay profiles of the entire genome and of genes regulated by a stability and a de-stability motif (a) Decay profile of the entire genome; the black ... mammalian counterpart 3' UTR motif Examples of yeast 3' UTR motifs and their best mammalian counterpart 3' UTR motif All 72 mammalian motifs were transformed into alignments and then PSSMs, and...
  • 15
  • 211
  • 0
Exergoeconomic analysis of a combined water and power plant 3

Exergoeconomic analysis of a combined water and power plant 3

Ngày tải lên : 14/09/2015, 08:36
... water baths have a capacity of 10 litres and can supply a maximum pumping power of 25KW Variables such as the heat medium temperature and feed temperature are altered using the hot water bath and ... 4.6 .3 Experimental program Saline water is used to simulate actual seawater While the concentration of seawater varies at different parts of the world, seawater around Singapore generally has a ... the evaporator The hot water flow rate can be controlled by means of a ball valve In the evaporator, an average vacuum pressure of 80 mbar is maintained with the help of a liquid ring vacuum...
  • 34
  • 223
  • 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Ngày tải lên : 25/10/2012, 11:00
... 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research ... history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare by themselves However, we have only ... MZ with discordant handedness showed opposite brain activity patterns in language and a mental rotation task Sommer et al 14 have suggested that late splitting of the egg may play a role in twins...
  • 4
  • 652
  • 0
Period 3: exercises of unit 10

Period 3: exercises of unit 10

Ngày tải lên : 01/06/2013, 08:47
... late to learn! Where are the eggs… were in the fridge A who B where C when D which What was the name of the man….wife became ill and was taken to hospital A who B whom C whose D which I have a ... which C whom D whose A widow is a person……husband is dead A who B which C whom D whose 10 Thank you very much for your letter…you told me a very interesting story of your holiday A on which B which ... …….I must read A who B when C where D which He was the first man ……left the burning building A who B which C whom D whose John is the man ….we are going to recommend for the job A who B which...
  • 2
  • 917
  • 0
BT 3   optimization of medium for indole 3 acetic acid production using pantoea agglomerans strain PVM

BT 3 optimization of medium for indole 3 acetic acid production using pantoea agglomerans strain PVM

Ngày tải lên : 06/08/2013, 21:06
... Biosynthesis of indole -3- acetic acid O .A Apine and J.P Jadhav Pantoea agglomerans is wide spread in many diverse natural and agricultural habitats, in particular it is associated with many plants as common ... and quantitative single-run analysis of acidic phytohormones and related compounds, and its application to Arabidopsis thaliana Planta 216, 44–56 Pedraza, R.O., Ramırez-Mata, A. , Xiqui, M.L and ... Indole -3- acetic acid production by Streptomyces sp isolated from some Thai medicinal plant rhizosphere soils EurAsia J Biosci 4, 23 32 Khandaswami, C and Vaidyanathan, C.S (19 73) Enzymatic assay of...
  • 10
  • 543
  • 1
Tài liệu ADC KRONE - White Paper - Data Center - 3 principles of Data Center Infrastructure Design (with n pptx

Tài liệu ADC KRONE - White Paper - Data Center - 3 principles of Data Center Infrastructure Design (with n pptx

Ngày tải lên : 10/12/2013, 03:15
... extra bandwidth and guaranteed zero bit errors In the data center, the smaller diameter of TrueNet Category cable saves as much as 32 % of available cable pathway space TrueNet Category cable offers ... of the frames and provide integrated front, rear, horizontal, and vertical management, eliminating the need for horizontal cable managers that take up valuable rack space The Glide Cable Management ... designed as a highly reliable and flexible utility to accommodate disaster recovery, upgrades and modifications Manageability starts with strategic, unified cable management that keeps cabling and...
  • 8
  • 523
  • 0

Xem thêm