3 apos and 5 apos of broadly expressed genes
Báo cáo y học: " Functions, structure, and read-through alternative splicing of feline APOBEC3 genes" ppt
Ngày tải lên :
14/08/2014, 08:20
... downstream of exon for all three A3C genes - A3Ca (positions 32 ,50 5, 33 ,37 6 and 33 ,444), A3Cb (positions 42,0 83, 42, 954 and 43, 022), and A3Cc (positions 22,960 and 23, 831 ) - and A3H (position 50 ,31 9) ... (EU01 636 2); lion A3C#1 (EU00 75 43) ; lion A3C#2 (EU00 754 4); lynx A3C#1 (EU00 754 6); lynx A3C#2 (EU01 636 3); lynx A3C #5 (EU00 754 7); lynx A3C#6 (EU00 754 8); puma A3C (EU00 754 5); leopard A3H (EU00 755 1); ... feline A3 promoters and that of human A3G [31 ], including two ETS-SP1 (A3Ca, A3Cb, A3Cc and A3H), IKRS-AP2 (A3H), and NFκB paired with either CEBP (A3Ca and A3Cb), RBPF (A3Ca, A3Cb and A3Cc) or...
- 20
- 264
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
Ngày tải lên :
17/03/2014, 10:20
... sp KSM- 6 35 and enzymatic properties Agric Biol Chem 53 , 12 75 1281 Fukumori, F., Kudo, T & Horikoshi, K (19 85) Purification and properties of a cellulase from alkalophilic Bacillus sp, 1 139 J Gen ... hilaris cellulase at 37 °C for h (B) Lane 1, standard sugars: G1, G2, G3, G4, cellopentaose (G5) and cellohexaose (G6) Lanes 2 5, G2–G5 treated with P hilaris cellulase at 37 °C for h and cellopentaose ... (F) and reverse (R) primers, Ó FEBS 20 03 Cellulase of the yellow-spotted longicorn beetle (Eur J Biochem 270) 34 57 1–24 (F), 209– 230 (F), 289 31 1 (R), 446–469 (R), 651 –680 (R), 667–688 (F), 7 13 740...
- 6
- 361
- 0
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
Ngày tải lên :
07/08/2014, 18:21
... C4 C5 C6 P1 P2 P3 P4 P5 P6 P7 438 88 438 89 438 92 438 94 29 (4-FS) 40 ( 139 8) 41 (9 73) 42 ( 75) 43 (796) 44 (1489) 30 09-88 (3D) 30 77-88 (3E) 31 04-88 (3C) 32 99- 85 (3A) C7-88 (4E) C681-87 (4D) C999-87 ... O 157 -C-1-2), and 14 USA isolates; strains of ATCC (A1, A2, A3, and A4), strains of Cornell University (C1, C2, C3, C4, C5, and C6), and strains of Pennsylvania State University (P3, P4, P5, and P7) ... coli O 157 :H7 Rapid kit 99 .58 (1,6 75/ 1,682)b 99.41 (1,672/1,682) 99 . 35 (1,671/1,682) 0.42 (7/1,682) 0 .59 (10/1,682) 0. 65 (11/1,682) a No of positive/No of samples examined No of negative/No of samples...
- 13
- 456
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
Ngày tải lên :
12/08/2014, 03:20
... 0. 23 0. 23 1.00E-47 6.00E -36 38 0 53 9 0. 23 9.70 31 1 FG228222 FC 932 702 FC 932 664 FC 932 731 FC 932 7 05 FC 932 694 FC 932 7 83 FC 932 656 FC 932 677 FG228218 FC 932 688 FC 932 771 FC 932 6 75 FC 932 662 FC 932 679 FC 932 804 ... 3. 00E-42 32 1 0. 23 0. 056 50 9 0. 23 8.00E-44 276 3. 76 2.00E-18 37 3 7.69 0.001 38 6 2.80 1.00E- 05 520 0. 23 9.00E-28 31 5 0. 93 1.00E-04 30 7 0. 23 0. 23 1.00E-62 2 .30 626 610 0. 23 2.00E-09 271 1.17 7.00E-22 457 ... (WC1) 0. 93 4.00E-46 657 0. 23 1.00E-64 5 43 1.40 8.00E-12 132 3. 76 4.00E-18 37 3 0. 23 3.00E-14 601 0. 23 3.00E-09 32 6 0. 23 2.00E-12 247 0. 23 2.00E- 25 254 0.47 0. 93 4.00E-67 6.00E-16 467 160 0. 23 3.00E-42...
- 25
- 292
- 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
Ngày tải lên :
12/08/2014, 05:20
... Actin EC969944 AT5G09810.1 AP47 EC 951 857 AT5G46 630 .1 Aquaporin EC9699 93 AT2G37170.1 Cyclophilin EC969926 AT4G34870.1 EC 959 059 AT5G6 039 0.1 PP2A CB980 232 AT3G 258 00.1 SAND CF4 054 09 AT2G2 839 0.1 Sucrose ... 0 .34 3 0 .50 4 0.600 0. 638 0.647 0.719 0. 733 1.0 15 1. 039 1.202 1.2 13 1.421 Actin PP2A EF1-α SAND GAPDH (m) UBC AP47 UBQ-L40 α-Tubulin MDH (m) UBQ (m) TIP41 -5 .33 3. 10 -1.86 2 .52 -1.02 -0. 43 0 .33 ... CB970967 CF5 151 10 EC 930 334 EC921711 AT5G 433 30.1 Malate dehydrogenase, cytosolic (other hit include AT1G04410.1 MDH cytosolic) CCATGCATCATCACCCACAA/ GTCAACCATGCTACTGTCAAAACC 72/1. 85 UBQ10 (m) EC9 238 97...
- 11
- 376
- 0
Báo cáo khoa học: Anti-HIV-1 activity of 3-deaza-adenosine analogs Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners pot
Ngày tải lên :
08/03/2014, 08:20
... hydrolase 0.007 0.0 23 0.24 0. 83 3.9 28.0 30 .1 50 .5 ± ± ± ± ± ± ± ± 0.002 0.008 0.04 0. 15 0.7 4.1 3. 0 7 .3 Ó FEBS 20 03 Anti-HIV-1 activity of 3- deaza-adenosine analogs (Eur J Biochem 270) 35 11 hydrolase ... Synthesis and evaluation of anti-HIV and antitumor activity of 2¢ ,3 -didehydro-2¢ ,3 -dideoxy -3- deaza-adenosine, 2¢ ,3 -dideoxy -3- deaza-adenosine, and some 2¢ ,3 -dideoxy -3- deaza-adenosine 5 -dialkyl ... simulations J Phys Chem 95, 33 58 33 63 33 Aqvist, J., Medina, C & Samuelsson, J.E (1994) A new method for predicting binding affinity in computer-aided drug design Protein Eng 7, 38 5 39 1 34 Hansson, T.,...
- 11
- 303
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
Ngày tải lên :
17/03/2014, 03:20
... (NT_01 136 2) 10 11 12 86 141 102 161 241 1 63 188 1 05 102 57 201 1468 197 96 161 241 1 63 188 1 05 102 204 139 8 279 45 93 2 63 1 25 116 1 63 188 1 05 102 256 6 256 93 161 241 1 63 188 1 05 102 204 219 26 15 233 ... 26 15 233 117 1 73 1 25 116 1 63 188 1 05 102 204 657 207 99 161 1 25 1 53 126 188 111 102 76 128 8 45 2 53 1284 1 23 136 259 0 Discussion Fig In vivo expression and response pattern to hypoxia of gcGLUT A ... GT1-F, 5 -CCTGATCGACGCACGAGT -3 and GT1-R, 5 -TTTTGCAAGTCATAGTAATCAGTTT -3 for GTcDNA1 (2 150 bp); and GT2-F, 5 -CACCAGCAACTAC CTGATCGA -3 and GT2-R, 5 -CACAAAATATGCTT CCAAGTGC -3 for GT-cDNA2 (30 43...
- 8
- 465
- 0
Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx
Ngày tải lên :
03/04/2014, 15:20
... spectrum of the product (CHCl3) 116 250 8,0 m 7 ,5 7,0 6 ,5 6,0 5, 5 5, 0 4 ,5 4,0 3, 5 3, 0 2 ,5 2,0 1 ,5 1,0 0 ,5 0,0 Figure 3: 1H-NMR spectrum of the product (50 0 MHz, CDCl3) Figure 4: 13C-NMR spectrum of ... [-CH(CH3)2] Signal at 3. 85 ppm (s, 3H) was assigned for - OMe protons Wavenumbers (cm-1) Figure 1: IR spectrum of isomeranzin (KBr) 190 131 71 260 89 1 03 51 1 75 146 201 217 50 100 150 2 43 200 Figure 2: ... [M+1]+, 260 [M+], 119 190 [M+1-COCH(CH3)2]+ 1H-NMR ( , ppm, CDCl3): 1.21 [d, 6H, j = 6. 93 Hz, 3 - CH(CH3)2]; 2. 83 (septet, 1H, 3 -H); 3. 85 (s, 3H, 7-OCH3); 4.00 (s, 2H, 1’ - CH2); 6.19 (d, 1H,...
- 6
- 384
- 0
fattorusso - modern alkaloids - structure, isolation, synthesis and biology (wiley, 2008)
Ngày tải lên :
04/06/2014, 15:25
... 13. 3.2 .3 13. 4 13. 4.1 13. 4.1.1 13. 4.1.2 13. 4.1 .3 13. 4.2 13. 4 .3 13. 4 .3. 1 13. 4 .3. 2 13. 5 13. 5. 1 13. 5. 2 13. 5. 2.1 13. 5. 2.2 13. 5 .3 13. 5 .3. 1 13. 5 .3. 2 13. 6 13. 6.1 13. 6.1.1 13. 6.1.2 13. 6.1 .3 13. 6.2 13. 6.2.1 ... 14.1 .3 14.2 14.2.1 14.2.2 14.2 .3 14.2.4 14 .3 14 .3. 1 14 .3. 2 14 .3. 3 14 .3. 4 14.4 15. 1 15. 1.1 4 73 477 Contents 15. 1.2 15. 2 15 .3 15 .3. 1 15 .3. 2 15 .3. 3 15 .3. 4 15 .3. 5 15. 4 15. 4.1 15. 4.2 15. 4 .3 15. 4.4 ... 4.9 .3 4.9.4 4.9 .5 4.9.6 4.9.7 4.9.8 4.9.9 4.9.10 4.9.11 4.9.12 4.9. 13 4.9.14 4.10 4.11 5. 1 5. 2 5. 2.1 5. 2.1.1 5. 2.1.2 5. 2.2 5. 2.2.1 5. 2.2.2 5. 2.2 .3 5. 2 .3 5. 2 .3. 1 5. 2 .3. 2 5. 2.4 5. 2.4.1 5. 2.4.2 5. 3...
- 691
- 227
- 0
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
Ngày tải lên :
18/06/2014, 15:20
... Relevant 34 33 19 30 43 29 36 35 26 40 35 23 45 41 25 37 34 21 32 34 18 28 35 22 Mean (n = 8) 35 36 23 SD 5 .3 3.6 3. 4 % CV 15% 10% 15% Cells TIL 152 0 TIL 152 0 TIL1 2 35 PBMC PBMC TIL1 2 35 TIL1 2 35 TIL 152 0 ... 261.9 238 .9 1/20000 33 .5 76.4 16.1 18 .3 8.9 8.2 34 7 .3 439 .2 1/10000 40.0 100.4 14.1 8.6 34 .5 65. 7 168.4 1 63. 8 1 /50 00 40.9 99.9 24.2 21.4 21.4 15. 0 258 .8 227 .3 1/1000 25. 9 63. 4 55 .2 30 .3 49.8 36 .9 ... HIV 15 2 4 5 4 2 3 2 7 2 241 Mean 3. 3 2.6 3. 5 35 .4 2 .5 SD 2.8 1 .3 1 .5 83. 2 2.1 Mean + SD 8.9 5. 2 6 .5 201.8 6.7 HLA-A2 PBMC (1 05 cells/well) from healthy donors were stimulated with peptides and...
- 25
- 639
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
Ngày tải lên :
18/06/2014, 18:20
... alignments of 30 Genogroup I sequences and 120 Genogroup II sequences The sequences were 400 bp segments of the ORF1-ORF2 junction (region 52 88 56 65 nts Southampton and region 50 05 53 8 7 nts Lordsdale) ... concentration of 7. 53 × 1 05 molecules of NoV cDNA or 7. 53 × 109 molecules per gram of stool The average number of NoV molecules per gram of stool was 1.02 × 109molecules Design of oligonucleotide ... molecules of plasmid DNA for GI NoV and × 107 to × 101 for GII NoV The R2 values for both standard curves were 1.00 with a slope of -3. 5 and -3. 7 respectively for GI and GII NoV (Fig 1B and Fig...
- 8
- 535
- 1
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx
Ngày tải lên :
19/06/2014, 08:20
... Slope: -3. 4 23, Intercept: 33 .5 03 Y =3. 423X + 33 .5 03 PCR efficiency 96.0%, 30 40 42 B 26 22 18 JCV T-antigen gene copy number Starting Copy Number (Log) 4x108 C I II 3x108 2x108 1x108 1x104 10 20 30 ... http://www.virologyj.com/content /3/ 1 /3 3000 A 2000 150 0 10 1f g fg 0f g 10 50 0 1p g pg 1000 10 PCR baseline subtracted CF RFU 250 0 -50 0 Threshold cycle (Ct) 34 10 12 14 16 18 20 22 24 Cycle number 26 28 30 32 34 36 38 Co-relation ... 106X - 35 0714 and Y = × 106X + × 107 and the r2 were 1.0 and 0. 95 for JCV(Mad1) virus stocks I and II, respectively Page of (page number not for citation purposes) Virology Journal 2006, 3: 3 and...
- 5
- 358
- 0
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
Ngày tải lên :
20/06/2014, 01:20
... alignments of 30 Genogroup I sequences and 120 Genogroup II sequences The sequences were 400 bp segments of the ORF1-ORF2 junction (region 52 88 56 65 nts Southampton and region 50 05 53 8 7 nts Lordsdale) ... concentration of 7. 53 × 1 05 molecules of NoV cDNA or 7. 53 × 109 molecules per gram of stool The average number of NoV molecules per gram of stool was 1.02 × 109molecules Design of oligonucleotide ... molecules of plasmid DNA for GI NoV and × 107 to × 101 for GII NoV The R2 values for both standard curves were 1.00 with a slope of -3. 5 and -3. 7 respectively for GI and GII NoV (Fig 1B and Fig...
- 8
- 502
- 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx
Ngày tải lên :
20/06/2014, 04:20
... Slope: -3. 4 23, Intercept: 33 .5 03 Y =3. 423X + 33 .5 03 PCR efficiency 96.0%, 30 40 42 B 26 22 18 JCV T-antigen gene copy number Starting Copy Number (Log) 4x108 C I II 3x108 2x108 1x108 1x104 10 20 30 ... http://www.virologyj.com/content /3/ 1 /3 3000 A 2000 150 0 10 1f g fg 0f g 10 50 0 1p g pg 1000 10 PCR baseline subtracted CF RFU 250 0 -50 0 Threshold cycle (Ct) 34 10 12 14 16 18 20 22 24 Cycle number 26 28 30 32 34 36 38 Co-relation ... 106X - 35 0714 and Y = × 106X + × 107 and the r2 were 1.0 and 0. 95 for JCV(Mad1) virus stocks I and II, respectively Page of (page number not for citation purposes) Virology Journal 2006, 3: 3 and...
- 5
- 327
- 0
Báo cáo nghiên cứu nông nghiệp " Isolation, inbreeding and relationships in forest trees " pdf
Ngày tải lên :
22/06/2014, 13:20
... 35 57 47 45 36 10 52 46 15 55 37 58 12 11 26 43 18 49 53 22 50 40 34 13 48 30 21 19 51 29 17 44 54 14 60 20 38 25 59 39 56 32 27 16 28 23 33 40 29 20 30 44 38 36 52 14 37 48 32 12 50 45 27 33 ... 16 57 17 34 21 53 45 26 12 49 56 30 52 24 50 27 31 33 54 44 27 45 44 13 37 20 16 30 25 40 54 14 57 29 28 41 11 58 49 10 18 24 55 22 47 34 15 42 50 23 43 39 31 52 46 32 53 17 38 12 21 33 36 60 56 ... 27 33 35 53 25 59 51 58 28 11 24 10 26 47 13 23 43 19 49 34 54 56 21 60 18 17 55 41 31 16 15 42 39 46 22 57 35 22 25 42 55 15 39 43 47 13 37 20 48 46 59 38 10 40 36 19 18 23 58 14 11 28 32 51 60...
- 29
- 250
- 0
Báo cáo y học: "Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter" docx
Ngày tải lên :
09/08/2014, 10:20
... years 0 .55 9 1.089 0.062 -0.1 03 0.676 863CC -0.062 0.809 857 CC -0.110 0 .37 5 30 8GG -0.299 0. 039 238 GG -0 .31 5 0. 255 1 036 TT -0.0 03 0.992 863CC 0.222 0.4 05 857 CC -0.129 0 .32 0 30 8GG 0.041 0. 731 238 GG ... 0.480 863CC -0.286 0.661 0.147 0. 659 0. 050 0.970 0.686 0 .51 4 -1.992 0.160 857 CC -0.289 0 .31 4 0.074 0.620 -0 .38 4 0.480 -0.7 73 0.0 93 -0.829 0.190 30 8GG -0 .50 7 0.080 0. 133 0 .39 5 -0 .38 0 0 .51 0 -1. 133 0.027 ... 0.6 63 1.2 53 0. 136 1 .51 2 0.117 857 CC -0.002 0.996 0. 036 0. 834 -0.860 0.049 0.076 0.8 73 -1.217 0.006 30 8GG -0. 151 0 .5 63 0.041 0.800 -0 .33 7 0.427 1. 736 0.002 0.496 0. 257 238 GG Coeff P value 1 036 TT...
- 10
- 367
- 0
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
Ngày tải lên :
10/08/2014, 05:21
... Sequence E18 -5' 5' -CTGGCACTGCTTTCCAGCAT -3' E18 -3' 5' -GCTTGCAAGGACTCTGGGCT -3' E19 -5' 5' -GCATCGCTGGTAACATCCAC -3' E19 -3' 5' -AGATGAGCAGGGTCTAGAGC -3' E20 -5' 5' -ATCGCATTCATGCGTCTTCA -3' E20 -3' 5' -AGACCGCATGTGAGGATCCT -3' ... 5' -AAACTGAATTCAAAAAGATCAAAGTGCTGG -3' 30 mer 2 2 35 -2249 del E746-A 750 del 5' -GAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAA -3' 35 mer 2 236 -2 250 del E746-A 750 del 5' -TCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG -3' 41 mer 2 237 -2 254 del ... E746-T 751 del 5' -(T)20AGTTAAAATTCCCGTCGCTATCAAGG -3' 46 mer 2240-2 257 del L747-S 752 del 5' -(T)23AGTTAAAATTCCCGTCGCTATCAAGGAAT -3 52 mer 25 73 T>G L 858 R 5' -(T)26ACCGCAGCATGTCAAGATCACAGATTTTGGGC -3' 58 ...
- 6
- 234
- 0
báo cáo khoa học: "Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)" doc
Ngày tải lên :
11/08/2014, 11:21
... mono-nt % 29 89 28 13 16 1 75 16.6 50 .9 16.0 7.4 9.1 100 32 2 56 2 104 1 93 2 83 1464 0.0 22.0 38 .4 7.1 13. 2 19 .3 100 468 32 2 56 2 104 1 93 2 83 1 932 24.2 16.7 29.1 5. 4 10.0 14.6 100 36 Additional Files ... 4219 unigenes were identified These consisted of 1 238 singletons (29 .3 % of unigenes and 17 .5 % of sequences) and 2981 contigs (70.7 % of unigenes and 42.1 % of sequences) assembled with CAP3 On ... 1, 238 2,981 4,219 59 .6% 5 63. 8 677.9 56 8 .3 Ramírez 21,096 15, 781 5, 7 03 2,266 7,969 50 .5% 606.2 606.2 59 4.7 Tibivilliers1 20, 736 37 ,919 3, 54 4 7 ,51 0 10 ,58 1 27.9 % 656 .4 1024.2 691.7 clones from Thibivilliers...
- 44
- 252
- 0
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx
Ngày tải lên :
11/08/2014, 11:21
... National Basic Research Program of China (2007CB109000), 8 63 Project of China (2007AA10Z 138 , 2006AA10A104) and National Natural Science Foundation of China (30 87 152 9, 30 87 152 8) Quantitative Real-Time ... proteinase K and DNA was extracted and dissolved in 50 μl of ddH2O Additional file 6: Categories of siRNAs corresponding to SRP1 and SRP3 7S RNA variants and sequences of SRP1 and SRP2 corresponding siRNAs ... sequences of of SRP1 and SRP3 corresponding siRNAs Additional file 7: Primer sequences for 5 RACE and real time PCR The table displays the sequences of primers used for both 5 RACE and real time...
- 13
- 417
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
Ngày tải lên :
12/08/2014, 04:21
... 74/86 75/ 87 75/ 87 98/99 91/96 EF0 633 83 CL3 Ca5 13 75/ 86 74/ 85 75/ 87 75/ 86 75/ 87 75/ 86 99/99 98/98 91/96 91/ 95 EF0 633 84 EF0 633 89 CL4 74/87 75/ 87 75/ 88 92/98 99/98 EF0 633 85 Ca5 73/ 86 75/ 87 75/ 88 92/98 ... -/- 93/ 96 94/96 75/ 87 73/ 85 AJ 437 481 M57 97/99 94/97 94/97 74/87 73/ 85 AY31 139 5 Uran 97/99 94/96 94/96 74/86 73/ 85 AY31 139 4 German Italy 93/ 96 93/ 96 97/97 -/- 98/98 97/97 75/ 87 75/ 87 74/86 75/ 86 ... 75/ 86 X57440 X 851 14 Russia 94/96 97/97 -/- 75/ 88 74/86 [2] Russia-W 94/96 97/97 99/99 75/ 87 74/86 D14449 Idaho 75/ 87 75/ 87 75/ 88 -/- 92/96 AF0 238 77 Ca508 74/87 75/ 87 75/ 88 99/99 92/96 EF0 633 88 CL1...
- 7
- 452
- 0