3 a diff erent business process for each type of proposal

Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

Ngày tải lên : 18/06/2014, 19:20
... Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, Shimizu T, Kangawa K, et al: Monolayered mesenchymal stem cells repair scarred myocardium after myocardial infarction Nat Med ... non-cell based alternative for using MSC in treatment of cardiovascular disease [ 23] Non-cell based therapies as opposed to cell-based therapies are generally easier to manufacture and are safer as ... Hornung CA, ZubaSurma EK, Al-Mallah M, Dawn B: Adult bone marrow-derived cells for cardiac repair: a systematic review and meta-analysis Archives of internal medicine 2007, 167(10):989-997 Mazhari...
  • 10
  • 343
  • 0
báo cáo hóa học:" Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs" doc

báo cáo hóa học:" Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic immortalization of human ESC-derived MSCs" doc

Ngày tải lên : 20/06/2014, 03:20
... Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, Shimizu T, Kangawa K, et al: Monolayered mesenchymal stem cells repair scarred myocardium after myocardial infarction Nat Med ... non-cell based alternative for using MSC in treatment of cardiovascular disease [ 23] Non-cell based therapies as opposed to cell-based therapies are generally easier to manufacture and are safer as ... Hornung CA, ZubaSurma EK, Al-Mallah M, Dawn B: Adult bone marrow-derived cells for cardiac repair: a systematic review and meta-analysis Archives of internal medicine 2007, 167(10):989-997 Mazhari...
  • 10
  • 348
  • 0
Web-Based Learning Environment: A Theory-Based Design Process for Development and Evaluation pdf

Web-Based Learning Environment: A Theory-Based Design Process for Development and Evaluation pdf

Ngày tải lên : 29/06/2014, 02:20
... They argue that measuring the impact of media on learning is futile in comparison studies For example, Lockee et al maintain that media comparison studies are badly flawed because of a lack of randomization ... individual, and group of evaluators) to evaluate various aspects of the web-based learning environment (e.g., individual and group learning activities) As a formative evaluation process, Dick & Carey ... instruction and user interface system As the evaluation process, Dick & Carey’s (1996) evaluation approach may be the best candidate, because this approach allows different types of evaluators (e.g.,...
  • 21
  • 383
  • 0
Báo cáo y học: " A scalable, fully automated process for construction of sequence-ready barcoded libraries for 454" pps

Báo cáo y học: " A scalable, fully automated process for construction of sequence-ready barcoded libraries for 454" pps

Ngày tải lên : 09/08/2014, 20:21
... text Additional file A figure containing a process map for plate-based fragment library construction with details of automation used for each step Additional file A figure containing a process map ... that are encoded in 454 flowspace In addition to scalability and barcoding, the automated process offers additional advantages Process steps are standardized by automation, eliminating operator-introduced ... Véronneau S, Dow S, LucauDanila A, Anderson K, André B, Arkin AP, Astromoff A, El-Bakkoury M, Bangham R, Benito R, Brachat S, Campanaro S, Curtiss M, Davis K, Deutschbauer A, Entian KD, Flaherty...
  • 9
  • 402
  • 0
Báo cáo y học: "A scalable, fully automated process for construction of sequence-ready human exome targeted capture libraries" pot

Báo cáo y học: "A scalable, fully automated process for construction of sequence-ready human exome targeted capture libraries" pot

Ngày tải lên : 09/08/2014, 22:23
... details AFA, adaptive focused acoustics Performance quality control of automation The Bravo automated liquid handling platform is assayed daily for dispense accuracy and precision using a quantitative ... handles large numbers of samples must have a supporting sample tracking system that preserves sample identification and manages association of critical process data necessary for analysis As part of ... Sequencing and Analysis Program, Broad Institute of MIT and Harvard, 32 0 Charles Street, Cambridge, MA 02141, USA 3Genetic Analysis Platform, Broad Institute of MIT and Harvard, 32 0 Charles Street, Cambridge,...
  • 15
  • 691
  • 0
Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent

Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent

Ngày tải lên : 05/09/2013, 08:40
... such as ozone alone and UV alone Materials and Methods Raw water characteristics Sewage effluent water from a sewage treatment plant in W city was used as sample The typical water quality characteristics ... (CODCr, BOD5, TOC, A2 54 (UV absorbance at 254nm), pH and alkalinity) of the sample are shown in Table Table Typical water quality characteristics of sewage effluent Parameters Values CODCr (mg/L) ... or UV Radiation on the Chemical Degradation and Biodegradability of Debittering Table Olive Industrial Wastewaters”, Water Res 33 (3) :7 237 32 (1999) Staehelin J and J Hoigné, “Decomposition of Ozone...
  • 13
  • 606
  • 1
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Ngày tải lên : 05/09/2013, 09:38
... TTCCCAATATCAACGCATTT, Ntspn994, CAAGGCGGTCCCAAGCAA, Ntcoc84, TCGCCAGCCACCTTTCCG, Ntcoc206, CGGTGCGAGCTTGCAAGC (Juretschko et al 2000) Quanching Primer method (Kurata et al., 2001) , one of quantitative ... the manufacturer In the preliminary step to nawwor down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed ... the cause of partial nitriifcation, the authors operated a test plant using simulated coak-oven wastewater prepared with chemical reagents for a period of about one year The nitrifiers population...
  • 8
  • 572
  • 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater

Ngày tải lên : 05/09/2013, 09:38
... REFERENCES Standard Methods for the Examination of Water and Wastewater (1995) 19th edn, American Public Health Association/American Water Works Association/Water Environment Federation, Washington ... equilibrium organic substances concentration (mg/L); qm and b are constant characteristic of the system for the Langmuir model that can be considered as an indicator of adsorptive capacity and appetency, ... regeneration tank was appropriate for this CARS process Time (d) 60 50 40 30 20 10 0 Time (d) Fig - Variations of COD, NH4+-N, and PO 43 P removals vs time at different HRTs of the regeneration tank...
  • 8
  • 686
  • 0
The bioliq® bioslurry gasification process for the production of biosynfuels, organic chemicals, and energy pdf

The bioliq® bioslurry gasification process for the production of biosynfuels, organic chemicals, and energy pdf

Ngày tải lên : 14/03/2014, 19:20
... harvested in an energy plantation of only 30 km in diameter at an annual harvest of 20 t/ha An advantage of colocation is that sufficient low-temperature waste heat is available in a BTL plant for drying ... lignocellulose as a raw material, a significant share of the total bioenergy harvest Carbon materials are also needed for iron ore reduction, ca 0.5 Gtoe /a of charcoal might be a reasonable estimate toward ... kWh(th)/m2/year, with a large regional scatter of at least half an order of magnitude Harvest expectations for plantations are kg of dry biomass (containing ca kg of carbon) per m2 and year Biomass combustion...
  • 44
  • 1.5K
  • 0
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

Ngày tải lên : 17/03/2014, 00:20
... types, for a total of millions of constraints—and these are variables and constraints over a domain of sets, not integers or reals General-purpose set programming software cannot handle such instances ... programming is clear: we create a set variable for every type, force the maximal types’ sets to contain at least λ + elements, and then use subset to enforce that every type is a superset of all ... However, at first blush our instances are much too large for readily-available set programming tools Grammars like ERG contain thousands of types We use binary constraints between every pair of types,...
  • 10
  • 410
  • 0
Báo cáo khoa học: "A Cascaded Finite-State Parser for Syntactic Analysis of Swedish" potx

Báo cáo khoa học: "A Cascaded Finite-State Parser for Syntactic Analysis of Swedish" potx

Ngày tải lên : 17/03/2014, 22:20
... different types of subordinate clauses; while Grammar4 recognizes main clauses A unique level is designated for each type of clause 3. 3 G r a m m a t i c a l Functions Grammatical functions are heuristically ... information as well as grammatical functions in the output A corpus, annotated syntactically, is a rich source of information which we intend to use for a number of applications, e.g information ... input, as well as the head of each phrase and the grammatical functions: TIME, SUBJ(ect) and P-0BJ(ect) Evaluation The performance of the parser partly depends on the output of the tagger and the...
  • 4
  • 288
  • 0
Constructing a City: The Cerda Plan for the Extension of Barcelona pdf

Constructing a City: The Cerda Plan for the Extension of Barcelona pdf

Ngày tải lên : 24/03/2014, 21:20
... JaumeLlobet,andMiquelCorominas,2 03- 21 Barcelona: Txatxo Sabater, JoaquimSabater, FundacioCaixa de Catalunya/Collegi d'Arquitectesde Catalunya 990b El Quadratd'Or: Centrede la Barcelonamodernista:Laformacio d'un espai ... urba, edited by Ferran Sagarra,Txatxo Sabater,JoaquimSabater,JaumeLlobet, and Miquel Corominas,97-1 13 Barcelona:FundacioCaixa de Catalunya/Collegi d'Arquitectesde Catalunya a Aibar,Bijker/ Constructing ... Barcelona dins del projecte industrialistacatala In La formacio de l'Eixample de Barcelona: Aproximacionsa un fenomen urba, edited by FerranSagarra, TxatxoSabater,JoaquimSabater,JaumeLlobet, and...
  • 29
  • 1.9K
  • 0
Báo cáo sinh học: "A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" pot

Báo cáo sinh học: "A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" pot

Ngày tải lên : 18/06/2014, 22:20
... fabricated by cyclic anodization Small 2009, 5: 139 2- 139 7 [24] Ueno M, Shinada K, Yanagisawa T, Mori C, Yokoyama S, Furukawa S, Takehara S, Kawaguchi Y: Clinical oral malodor measurement with a ... Structural characterisation of prepared AAO SEM images of the nanoporous AAO structure fabricated by anodization of Al in 0 .3 M oxalic acid from the top surface and in cross-sectional view are shown ... analytical applications A comparative study with gas chromatographic analysis will be performed to evaluate more precisely the performance of our Au-AAO sensor for malodour measurements and potential...
  • 16
  • 388
  • 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Ngày tải lên : 18/06/2014, 22:20
... CTGGCTAACGACTACATCTCCAGRGAYGARCT -3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG -3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG -3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG -3' 5'-TACAAAATACAGCGAGTGATANATRAARCA -3' ORF 59 (RFHV/KSHV)7 ... 5'-TCTGAATATGTCACATCCGTTCATA -3' 5'-GGCCCGGAAAATGAGTAACA -3' 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC-(BHQ-1) -3' Exon OSM Exon OSM Exon OSM 5'-CCTCGGGCTCAGGAACAAC -3' 5'-GGCCTTCGTGGGCTCAG -3' 5'-(6-FAM)-TACTGCATGGCCCAGCTGCTGGACAA-(BHQ-1) -3' ... "RV 2a" (forward primer 5'-TCTGAATATGTCACATCCGTTCATA -3' ) and "RV2b" (reverse primer 5'GGCCCGGAAAATGAGTAACA -3' ) with a TaqMan probe "RV2" 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC(BHQ-1) -3' (Table and...
  • 12
  • 509
  • 0
Báo cáo hóa học: " Reemergence of dengue virus type-3 (subtype-III) in India: Implications for increased incidence of DHF & DSS" docx

Báo cáo hóa học: " Reemergence of dengue virus type-3 (subtype-III) in India: Implications for increased incidence of DHF & DSS" docx

Ngày tải lên : 20/06/2014, 01:20
... R, Jana AM: Emergence of dengue virus type -3 in northern India Southeast Asian J Trop Med Public Health 2005, 36 :25 -32 Kumar M, Pasha ST, Mittal V, Rawat DS, Arya SC, Agarwal N, Bhattacharya D, ... Upadhyay C, Saxena P, Jana AM: Serological and Virological investigation of an outbreak of dengue fever in Gwalior, India Ind J Med Res 2002, 116:248-54 Dash PK, Saxena P, Abhyankar A, Bhargava ... P, Dash PK, Jana AM, Seth P: Evaluation of a Dipstick ELISA and a rapid Immunochromatographic test for diagnosis of dengue virus infection Acta Virologica 2000, 45:299 -30 4 Yamada K, Takasaki...
  • 10
  • 385
  • 0
báo cáo hóa học:" A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" pdf

báo cáo hóa học:" A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" pdf

Ngày tải lên : 20/06/2014, 04:20
... fabricated by cyclic anodization Small 2009, 5: 139 2- 139 7 [24] Ueno M, Shinada K, Yanagisawa T, Mori C, Yokoyama S, Furukawa S, Takehara S, Kawaguchi Y: Clinical oral malodor measurement with a ... Structural characterisation of prepared AAO SEM images of the nanoporous AAO structure fabricated by anodization of Al in 0 .3 M oxalic acid from the top surface and in cross-sectional view are shown ... analytical applications A comparative study with gas chromatographic analysis will be performed to evaluate more precisely the performance of our Au-AAO sensor for malodour measurements and potential...
  • 16
  • 531
  • 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

Ngày tải lên : 20/06/2014, 04:20
... CTGGCTAACGACTACATCTCCAGRGAYGARCT -3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG -3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG -3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG -3' 5'-TACAAAATACAGCGAGTGATANATRAARCA -3' ORF 59 (RFHV/KSHV)7 ... 5'-TCTGAATATGTCACATCCGTTCATA -3' 5'-GGCCCGGAAAATGAGTAACA -3' 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC-(BHQ-1) -3' Exon OSM Exon OSM Exon OSM 5'-CCTCGGGCTCAGGAACAAC -3' 5'-GGCCTTCGTGGGCTCAG -3' 5'-(6-FAM)-TACTGCATGGCCCAGCTGCTGGACAA-(BHQ-1) -3' ... "RV 2a" (forward primer 5'-TCTGAATATGTCACATCCGTTCATA -3' ) and "RV2b" (reverse primer 5'GGCCCGGAAAATGAGTAACA -3' ) with a TaqMan probe "RV2" 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC(BHQ-1) -3' (Table and...
  • 12
  • 471
  • 0
Báo cáo hóa học: " A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" docx

Báo cáo hóa học: " A nanoporous interferometric micro-sensor for biomedical detection of volatile sulphur compounds" docx

Ngày tải lên : 20/06/2014, 23:20
... Results and discussion Structural characterisation of prepared AAO SEM images of the nanoporous AAO structure fabricated by anodization of Al in 0 .3 M oxalic acid from the top surface and in cross-sectional ... optical sensors: principles and selected applications Anal Bioanal Chem 2005, 38 1:141-155 13 Gauglitz G: Direct optical detection in bioanalysis: an update Anal Bioanal Chem 2010, 39 8: 236 3- 237 2 Page ... geometries and complex pore architectures fabricated by cyclic anodization Small 2009, 5: 139 2- 139 7 24 Ueno M, Shinada K, Yanagisawa T, Mori C, Yokoyama S, Furukawa S, Takehara S, Kawaguchi Y: Clinical...
  • 7
  • 391
  • 0
Báo cáo hóa học: "Single step process for the synthesis of carbon nanotubes and metal/alloy-filled multiwalled carbon nanotubes" docx

Báo cáo hóa học: "Single step process for the synthesis of carbon nanotubes and metal/alloy-filled multiwalled carbon nanotubes" docx

Ngày tải lên : 22/06/2014, 22:20
... based AB2 alloy, obtained after several cycles of hydrogenation/dehydrogenation, was directly placed in a quartz boat and kept at the center of a quartz tube, which was placed inside a tubular furnace ... constituents of the alloy, with a composition comparable to that of the initial alloy used for the preparation of hydride catalysts Figure 2b shows the EDX spectra of Nifilled MWNT TEM and HRTEM images of ... obtained at a growth temperature of 950°C are respectively shown in Fig 3a and b It can be seen that SWNTs are of larger diameter of around nm Alloy filling inside SWNTs was not observed The carbon...
  • 6
  • 363
  • 0
Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx

Báo cáo y học: "Genomic transcriptional profiling identifies a candidate blood biomarker signature for the diagnosis of septicemic melioidosis" ppsx

Ngày tải lên : 09/08/2014, 20:20
... [GenBank:NM_006120 .3] forward primer, 5'-agctgcgctgctacagatg -3' , and reverse primer, 5'-tggccacattggagtagga -3' ; MYOF [GenBank:NM_ 133 337 .2] forward primer, 5'-agcacgtggaaacaaggact -3' , and reverse primer, 5'-ccacccacatctgaagttttc -3' ; ... 5'ttctgcagctgaaattctgg -3' , and reverse primer, 5'-tgcatgctctgtggctttac -3' ; LAP3 [GenBank:NM_015907.2] forward primer, 5'-gctggaaagctgagagagactt -3' , and reverse primer, 5'-cctgatgcagaccataaaagg -3' ; HLA-DMA [GenBank:NM_006120 .3] ... [GenBank:NM_002818.2] forward primer, 5'-gggaatgagaaagtcctgtcc -3' , and reverse primer, 5'-tcaatcttggggatcaggtg -3' ; HLA-DRA [GenBank:NM_019111 .3] forward primer, 5'-caagggattgcgcaaaag3', and reverse...
  • 22
  • 395
  • 0