3 2 axis drilling example for users with multiaxis licence
Báo cáo y học: " Functions, structure, and read-through alternative splicing of feline APOBEC3 genes" ppt
Ngày tải lên :
14/08/2014, 08:20
... for all three A3C genes - A3Ca (positions 32 ,505, 33 ,37 6 and 33 ,444), A3Cb (positions 42, 0 83, 42, 954 and 43, 022 ), and A3Cc (positions 22 ,960 and 23 , 831 ) - and A3H (position 50 ,31 9) 20 k A3Cc 22 k ... J Virol Genome Biology 20 08, 9:R48 http://genomebiology.com /20 08/9 /3/ R48 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Genome Biology 20 08, 20 07, 81:7048-7060 Wheelan ... leopard A3C (DQ205650); tiger A3C#1 (DQ0 933 75); tiger A3C #2 (EU01 636 1); tiger A3C #3 (EU01 636 2) ; lion A3C#1 (EU0075 43) ; lion A3C #2 (EU007544); lynx A3C#1 (EU007546); lynx A3C #2 (EU01 636 3); lynx A3C#5...
- 20
- 264
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
Ngày tải lên :
17/03/2014, 10:20
... Biochem J 165, 33 –41 15 Park, S.R., Cho, S.J., Kim, M.K., Ryu, S.K., Lim, W.J., An, C.L., Hong, S.Y., Kim, J.H., Kim, H & Yun, H.D (20 02) Activity 16 17 18 19 20 21 22 23 24 25 26 27 28 29 enhancement ... Saitama, 33 1-8 537 Japan; www.brain.go.jp) and by the Pioneer Research Project Fund (No PRPF-0 022 ) from the Ministry of Ó FEBS 20 03 3460 M Sugimura et al (Eur J Biochem 27 0) Agriculture, Forestry ... yellow-spotted longicorn beetle (Eur J Biochem 27 0) 34 57 1 24 (F), 20 9– 23 0 (F), 28 9 31 1 (R), 446–469 (R), 651–680 (R), 667–688 (F), 7 13 740 (F), 781–807 (R) and 995–10 13 (R), were designed from the cDNA...
- 6
- 361
- 0
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
Ngày tải lên :
07/08/2014, 18:21
... Sources A1 A2 A3 A4 C1 C2 C3 C4 C5 C6 P1 P2 P3 P4 P5 P6 P7 438 88 438 89 438 92 438 94 29 (4-FS) 40 ( 139 8) 41 (9 73) 42 (75) 43 (796) 44 (1489) 30 09-88 (3D) 30 77-88 (3E) 31 04-88 (3C) 32 99-85 (3A) C7-88 ... P010 726 -18; lane 2, P010 726 -21 ; lane 3, P010 726 -22 ; lane 4, P010 726 - 23 ; lane 5, P010 726 -24 ; lane 6, P010 726 -25 ; lane 7, P010 726 -26 ; lane 8, E01 020 6- 13- 2; lane 9, J01 030 3-11-1; lane 10, O157-R1 -3- 2; ... lane 4, P010 726 - 23 ; lane 5, P010 726 -24 ; lane 6, P010 726 -25 ; lane 7, P010 726 -26 ; lane 8, E01 020 6- 13- 2; lane 9, J01 030 3-11-1; lane 10, O157-R1 -3- 2; lane 11, O157-C-1 -2; lane 12, ATCC 438 94 (a positive...
- 13
- 456
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
Ngày tải lên :
12/08/2014, 03:20
... FC 9 32 731 FC 9 32 705 FC 9 32 694 FC 9 32 7 83 FC 9 32 656 FC 9 32 677 FG 228 218 FC 9 32 688 FC 9 32 771 FC 9 32 675 FC 9 32 6 62 FC 9 32 679 FC 9 32 804 FC 9 32 737 FC 9 32 759 FC 9 32 684 FC 9 32 706 FC 9 32 765 FG 228 209 FG 228 219 FC 9 32 666 ESTs ... 520 0. 23 9.00E -28 31 5 0. 93 1.00E-04 30 7 0. 23 0. 23 1.00E- 62 2 .30 626 610 0. 23 2. 00E-09 27 1 1.17 7.00E -22 457 0. 23 0. 23 1.00E-47 6.00E -36 38 0 539 0. 23 9.70 31 1 FG 228 222 FC 9 32 7 02 FC 9 32 664 FC 9 32 731 ... 8 03 0. 23 2. 00E-66 804 0.47 7.6 22 5 0. 23 2. 00E-74 486 0.70 1.00E -31 441 0.70 5.00E -30 439 FC 9 32 6 72 FC 9 32 674 FC 9 32 784 FG 228 211 FC 9 32 758 FC 9 32 738 FC 9 32 7 63 FC 9 32 670 FC 9 32 700 FC 9 32 718 FC 9 32 801 FG 228 215...
- 25
- 292
- 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx
Ngày tải lên :
12/08/2014, 05:20
... α-Tubulin MDH (m) UBQ (m) TIP41 -5 .33 3. 10 -1.86 2. 52 -1. 02 -0. 43 0 .33 -0.49 1. 23 1. 82 -2. 23 2 .36 0.4 62 0.496 0.604 0. 626 0. 630 0.689 0. 728 0.889 0.8 92 0. 925 0.984 1.057 Cyclophilin, EF1-α (m) ... α-Tubulin UBC UBQ-L40 UBQ (m) 2. 70 -2. 10 3. 38 1.00 -1.15 1 .37 -5.70 3. 79 0 .39 -1.19 0.96 -3. 44 0 .34 3 0.504 0.600 0. 638 0.647 0.719 0. 733 1.015 1. 039 1 .20 2 1 .2 13 1. 421 Actin PP2A EF1-α SAND GAPDH (m) ... Cyclophilin EC969 926 AT4G34870.1 EC959059 AT5G6 039 0.1 PP2A CB980 23 2 AT3G25800.1 SAND CF405409 AT2G2 839 0.1 Sucrose transporter EC 920 891 AT2G 028 60.1 TIP41 EC947050 AT4G3 427 0.1 α-Tubulin EC 930 869 AT5G19780.1...
- 11
- 376
- 0
Báo cáo khoa học: Anti-HIV-1 activity of 3-deaza-adenosine analogs Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners pot
Ngày tải lên :
08/03/2014, 08:20
... 0 .22 2. 84 0 .20 4.8 2. 5 2. 0 ± ± ± ± ± ± ± ± 0.009a 0.005a 0.02a 0 .3 0.02a 0 .2 0 .3 0 .2 The IC50 values from Mayers et al [10] Ki (lM) AdoHcy hydrolase 0.007 0.0 23 0 .24 0. 83 3.9 28 .0 30 .1 50.5 ± ... 0.59 3. 4 2. 6 0 .25 0 .28 1.0 1.4 ± ± ± ± 0.07 0.09 0 .27 0.10 ± ± ± ± 0. 03 0. 02 0.05 0.06 35 12 R K Gordon et al (Eur J Biochem 27 0) Ó FEBS 20 03 amount of 3- deaza-nucleotides formed (Table 2) , the ... activity of 2 ,3 -didehydro -2 ,3 -dideoxy -3- deaza-adenosine, 2 ,3 -dideoxy -3- deaza-adenosine, and some 2 ,3 -dideoxy -3- deaza-adenosine 5¢-dialkyl phosphates Nucleosides Nucleotides 10, 1551–15 62 21 Robins,...
- 11
- 303
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
Ngày tải lên :
17/03/2014, 03:20
... 105 1 02 57 20 1 1468 197 96 161 24 1 1 63 188 105 1 02 204 139 8 27 9 45 93 2 63 125 116 1 63 188 105 1 02 2566 25 6 93 161 24 1 1 63 188 105 1 02 204 21 9 26 15 23 3 117 1 73 125 116 1 63 188 105 1 02 204 657 20 7 ... (AAK0 937 7); chicken GLUT2 (Q905 92) ; human GLUT2 (AAA59514); mouse GLUT2 (P1 424 6); rat GLUT2 (P1 23 3 6); chicken GLUT3 (AAA486 62) ; mouse GLUT3 (AAH34 122 ); rat GLUT3 (Q07647); rabbit GLUT3 (Q9XSC2); ... gcGLUT (AY 23 1 476) GLUT1 (NT_0048 52) GLUT2 (NT_ 034 5 63) GLUT3 (NT_ 02 439 7) GLUT4 (NT_0108 23 ) Class II (human) GLUT5 (NT_ 028 054) Class III (human) GLUT10 (NT_01 136 2) 10 11 12 86 141 1 02 161 24 1 1 63 188...
- 8
- 465
- 0
Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx
Ngày tải lên :
03/04/2014, 15:20
... 620 C (from pentane) [2] ), [ ]D 00 (CHCl3) (00 [2] ) IR ( , cm-1, KBr) : 838 , 1 028 , 1115, 125 0, 129 1, 139 4, 15 02, 1608, 1719, 29 68 MS (m/z, CHCl3) : 26 1 [M+1]+, 26 0 [M+], 119 190 [M+1-COCH(CH3 )2] + ... CDCl3): 1 .21 [d, 6H, j = 6. 93 Hz, 3 - CH(CH3 )2] ; 2. 83 (septet, 1H, 3 -H); 3. 85 (s, 3H, 7-OCH3); 4.00 (s, 2H, 1’ - CH2); 6.19 (d, 1H, 4-H, j = 9.46 Hz); 6.84 (d, 1H, 6-H, j = 8.60 Hz); 7 .36 (d, ... Hz); 7. 62 (d, 1H, 3- H, j = 9.46 Hz) 13 C-NMR ( , ppm, CDCl3): 18. 42 (4’-C, 5’-C); 34 .69 (1’-C); 40.88 (3 -C); 56. 12 (7 - OCH3); 107 .26 (6-C); 111.95 (10-C); 1 12. 91 (8-C); 1 12. 97 (3- C); 127 .55 (5-C);...
- 6
- 384
- 0
fattorusso - modern alkaloids - structure, isolation, synthesis and biology (wiley, 2008)
Ngày tải lên :
04/06/2014, 15:25
... Weinheim ISBN: 978 -3- 527 -31 521 -5 VI Contents 2. 2 .2. 6 2. 2 .2. 7 2. 2 .2. 8 2. 2 .3 2. 2 .3. 1 2. 2 .3. 2 2 .3 2 .3. 1 2 .3. 2 2 .3. 3 2 .3. 4 2 .3. 5 2 .3. 6 2. 4 2. 4.1 2. 4 .2 2.5 2. 6 2. 7 Karenitecin 32 Lurtotecan 32 Rubitecan ... 36 9 LC-MS Overview 36 9 Contents 13. 2. 1 13. 2. 1.1 13. 2. 1 .2 13. 2. 1 .3 13. 2. 1.4 13. 3 13. 3.1 13. 3 .2 13. 3 .2. 1 13. 3 .2. 2 13. 3 .2 .3 13. 4 13. 4.1 13. 4.1.1 13. 4.1 .2 13. 4.1 .3 13. 4 .2 13. 4 .3 13. 4 .3. 1 13. 4 .3. 2 ... 13. 4 .3. 2 13. 5 13. 5.1 13. 5 .2 13. 5 .2. 1 13. 5 .2. 2 13. 5 .3 13. 5 .3. 1 13. 5 .3. 2 13. 6 13. 6.1 13. 6.1.1 13. 6.1 .2 13. 6.1 .3 13. 6 .2 13. 6 .2. 1 13. 6 .2. 2 13. 6 .3 13. 6 .3. 1 13. 6 .3. 2 13. 6 .3. 3 13. 7 Optimization 37 0 Modification...
- 691
- 227
- 0
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
Ngày tải lên :
18/06/2014, 15:20
... TIL1 520 TIL1 520 TIL1 23 5 Peptide gp10 020 9 gp100pool MART-1 Peptide specificity Relevant Relevant Relevant 34 33 19 30 43 29 36 35 26 40 35 23 45 41 25 37 34 21 32 34 18 28 35 22 Mean (n = 8) 35 36 ... 26 1.9 23 8 .9 1 /20 000 33 .5 76.4 16.1 18 .3 8.9 8 .2 34 7 .3 439 .2 1/10000 40.0 100.4 14.1 8.6 34 .5 65.7 168.4 1 63. 8 1/5000 40.9 99.9 24 .2 21.4 21 .4 15.0 25 8.8 22 7 .3 1/1000 25 .9 63. 4 55 .2 30 .3 49.8 36 .9 ... 12/ 12 80% 34 % 10 10 NA 8/ 12 NA NA 1 NA 3/ 12 NA NA 100,000 93, 334 8,400 12/ 12 93% 9% 10,000 10, 533 2, 001 12/ 12 105% 19% 1,000 1, 035 134 12/ 12 1 03% 13% 100 109 41.4 12/ 12 109% 38 % 10 14 NA 10/12...
- 25
- 639
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
Ngày tải lên :
18/06/2014, 18:20
... United States, 20 00 -20 04 J Infect Dis 20 06, 1 93( 3):4 13- 421 Lang L: Acute gastroenteritis outbreaks on cruise ships linked to Norwalk-like viruses Gastroenterology 20 03, 124 (2) :28 4 -28 5 Zheng DP, ... Hu/NoV/VannesL169 /20 00/France Hu/NLV/GII/Carlow /20 02/ Irl Hu/NoV/SU4-JPN /20 02/ JP Hu/NoV/Saitama T67GII /20 02/ JP Hu/NoV/Mc37 /20 04/JP Hu/NoV/Honolulu /31 4/1994/US Hu/NoV/Hiram /20 00/USA Hu/NoV/CS-E1 /20 02/ USA CDC, USA HPA, UK ... a denaturation at 94°C for min, followed by 40 cycles at 94°C for 30 s, 48°C for 30 s, 72 C for and a final extension at 72 C for The PCR products were separated on a 2% agarose gel and visualized...
- 8
- 535
- 1
Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx
Ngày tải lên :
19/06/2014, 08:20
... 16 18 20 22 24 Cycle number 26 28 30 32 34 36 38 Co-relation Coefficient 1.0, Slope: -3. 4 23 , Intercept: 33 .5 03 Y =3. 423 X + 33 .5 03 PCR efficiency 96.0%, 30 40 42 B 26 22 18 JCV T-antigen gene copy ... PCR for the detection of JC and BK viral nucleotide Page of (page number not for citation purposes) Virology Journal 20 06, 3: 3 16 17 18 19 20 21 22 23 24 25 26 http://www.virologyj.com/content /3/ 1 /3 ... 20 06, 3: 3 http://www.virologyj.com/content /3/ 1 /3 3000 A 20 00 1500 10 1f g fg 0f g 10 500 1p g pg 1000 10 PCR baseline subtracted CF RFU 25 00 -500 Threshold cycle (Ct) 34 10 12 14 16 18 20 22 24 ...
- 5
- 358
- 0
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
Ngày tải lên :
20/06/2014, 01:20
... United States, 20 00 -20 04 J Infect Dis 20 06, 1 93( 3):4 13- 421 Lang L: Acute gastroenteritis outbreaks on cruise ships linked to Norwalk-like viruses Gastroenterology 20 03, 124 (2) :28 4 -28 5 Zheng DP, ... Hu/NoV/VannesL169 /20 00/France Hu/NLV/GII/Carlow /20 02/ Irl Hu/NoV/SU4-JPN /20 02/ JP Hu/NoV/Saitama T67GII /20 02/ JP Hu/NoV/Mc37 /20 04/JP Hu/NoV/Honolulu /31 4/1994/US Hu/NoV/Hiram /20 00/USA Hu/NoV/CS-E1 /20 02/ USA CDC, USA HPA, UK ... a denaturation at 94°C for min, followed by 40 cycles at 94°C for 30 s, 48°C for 30 s, 72 C for and a final extension at 72 C for The PCR products were separated on a 2% agarose gel and visualized...
- 8
- 502
- 0
báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx
Ngày tải lên :
20/06/2014, 04:20
... 16 18 20 22 24 Cycle number 26 28 30 32 34 36 38 Co-relation Coefficient 1.0, Slope: -3. 4 23 , Intercept: 33 .5 03 Y =3. 423 X + 33 .5 03 PCR efficiency 96.0%, 30 40 42 B 26 22 18 JCV T-antigen gene copy ... PCR for the detection of JC and BK viral nucleotide Page of (page number not for citation purposes) Virology Journal 20 06, 3: 3 16 17 18 19 20 21 22 23 24 25 26 http://www.virologyj.com/content /3/ 1 /3 ... 20 06, 3: 3 http://www.virologyj.com/content /3/ 1 /3 3000 A 20 00 1500 10 1f g fg 0f g 10 500 1p g pg 1000 10 PCR baseline subtracted CF RFU 25 00 -500 Threshold cycle (Ct) 34 10 12 14 16 18 20 22 24 ...
- 5
- 327
- 0
Báo cáo nghiên cứu nông nghiệp " Isolation, inbreeding and relationships in forest trees " pdf
Ngày tải lên :
22/06/2014, 13:20
... 59 39 56 32 27 16 28 23 33 40 29 20 30 44 38 36 52 14 37 48 32 12 50 45 27 33 35 53 25 59 51 58 28 11 24 10 26 47 13 23 43 19 49 34 54 56 21 60 18 17 55 41 31 16 15 42 39 46 22 57 35 22 25 42 ... 18 24 55 22 47 34 15 42 50 23 43 39 31 52 46 32 53 17 38 12 21 33 36 60 56 35 51 26 48 59 19 21 60 26 18 40 54 46 11 59 27 19 43 33 56 15 52 31 51 39 48 45 14 17 38 22 16 49 13 32 28 50 25 37 ... 42 55 15 39 43 47 13 37 20 48 46 59 38 10 40 36 19 18 23 58 14 11 28 32 51 60 41 29 16 57 17 34 21 53 45 26 12 49 56 30 52 24 50 27 31 33 54 44 27 45 44 13 37 20 16 30 25 40 54 14 57 29 28 41 11...
- 29
- 250
- 0
Báo cáo y học: "Contribution for new genetic markers of rheumatoid arthritis activity and severity: sequencing of the tumor necrosis factor-alpha gene promoter" docx
Ngày tải lên :
09/08/2014, 10:20
... 0. 133 863CC -0. 037 0.944 0.548 0.099 0 .35 9 0.6 63 1 .2 53 0. 136 1.5 12 0.117 857CC -0.0 02 0.996 0. 036 0. 834 -0.860 0.049 0.076 0.8 73 -1 .21 7 0.006 30 8GG -0.151 0.5 63 0.041 0.800 -0 .33 7 0. 427 1. 736 ... 0.0 02 0.496 0 .25 7 23 8 GG Coeff P value 1 036 TT -0. 422 0.5 12 863CC >10 years P value 857CC to 10 years Coeff 863CC 10 years 1 036 TT 0.481 0.070 Coefficients were adjusted for gender, education,...
- 10
- 367
- 0
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
Ngày tải lên :
10/08/2014, 05:21
... primer extension Case(s) with EGFR mutation(s) L747-S7 52 del L858R -21 6 G/T 2 23 5 -22 49 del E746-A750 del 2 23 6 -22 50 del 22 40 -22 57 del 25 73 T>G Adenocarcinoma (n = 26 ) 3 Bronchioloalveolar carcinoma ... 5'-GAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAA -3' 35 mer 2 23 6 -22 50 del E746-A750 del 5'-TCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG -3' 41 mer 2 23 7 -22 54 del E746-T751 del 5'-(T )20 AGTTAAAATTCCCGTCGCTATCAAGG -3' 46 mer 22 40 -22 57 del L747-S7 52 ... following mutations: -21 6 G/T, 2 23 5 -22 49 del, 2 23 6 -22 50 del, 22 40 -22 57 del, and 25 73 T>G for detecting EGFR mutations in 81 cases of NSCLC The two protocols identified the same 26 mutations, but...
- 6
- 234
- 0
báo cáo khoa học: "Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)" doc
Ngày tải lên :
11/08/2014, 11:21
... w/ mono-nt % 29 89 28 13 16 175 16.6 50.9 16.0 7.4 9.1 100 32 2 5 62 104 1 93 2 83 1464 0.0 22 .0 38 .4 7.1 13. 2 19 .3 100 468 32 2 5 62 104 1 93 2 83 1 9 32 24 .2 16.7 29 .1 5.4 10.0 14.6 100 36 Additional ... 9,984 7,079 1, 23 8 2, 981 4 ,21 9 59.6% 5 63. 8 677.9 568 .3 Ramírez 21 ,096 15,781 5,7 03 2, 266 7,969 50.5% 606 .2 606 .2 594.7 Tibivilliers1 20 , 736 37 ,919 3, 544 7,510 10,581 27 .9 % 656.4 1 024 .2 691.7 clones ... function2 Antioxidant activity 34 0.9 28 1 .3 Binding 1656 42. 5 841 40.4 Catalytic activity 14 72 37 .8 704 33 .8 Electron carrier activity 108 2. 8 61 2. 9 Enzyme regulator activity 34 0.9 21 1.0 Metallochaperone...
- 44
- 252
- 0
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx
Ngày tải lên :
11/08/2014, 11:21
... M, Hotuta T, Kusano J, Kanehori K, Takahashi-Fujii A, Hara H, 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Tanase TO, Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, Arita M, Imose N, ... alternative splicing Curr Opin Struct Biol 20 04, 14 :2 73- 28 2 Yang XJ: Multisite protein modification and intramolecular signaling Oncogene 20 05, 24 :16 53- 16 62 Li L, Wang X, Sasidharan R, Stolc V, Deng ... signaling Science 20 06, 31 2: 436 - 439 Sunkar R, Chinnusamy V, Zhu J, Zhu JK: Small RNAs as big players in plant abiotic stress responses and nutrient deprivation Trends Plant Sci 20 07, 12 :30 1 -30 9 10 Erdmann...
- 13
- 417
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
Ngày tải lên :
12/08/2014, 04:21
... 99/99 98/98 91/96 91/95 EF0 633 84 EF0 633 89 CL4 74/87 75/87 75/88 92/ 98 99/98 EF0 633 85 Ca5 73/ 86 75/87 75/88 92/ 98 99/98 EF0 633 86 Ca 128 73/ 85 75/86 74/86 92/ 96 -/- EF0 633 87 * The length of the targeted ... [2] Russia-W 94/96 97/97 99/99 75/87 74/86 D14449 Idaho 75/87 75/87 75/88 -/- 92/ 96 AF0 23 8 77 Ca508 74/87 75/87 75/88 99/99 92/ 96 EF0 633 88 CL1 74/86 75/87 75/87 98/99 91/96 EF0 633 83 CL3 Ca5 13 ... Idaho PVM- Ca 128 Reference Hangzhou -/- 93/ 96 94/96 75/87 73/ 85 AJ 437 481 M57 97/99 94/97 94/97 74/87 73/ 85 AY31 139 5 Uran 97/99 94/96 94/96 74/86 73/ 85 AY31 139 4 German Italy 93/ 96 93/ 96 97/97 -/-...
- 7
- 452
- 0