3 11 the compensibility factor for natural gases as a function of pseudoreduced pressure and temperature
A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation
Ngày tải lên :
26/09/2015, 10:43
... Simple arrays readily created Table 1.1: The Advantages and Disadvantages of Microstrip Antennas It is actually the last advantage in the list above that makes microstrip antennas so popular today ... Figure 5.1: Samples of antennas fabricated for measurements of Variation in the “d” parameters 75 Figure 5.2: One of the two antennas (Antenna A & B) fabricated for angular variation measurements ... Quality Factors Finding the Q -factor of the antenna is an important part of studying the antenna via the cavity model The total quality factor of the antenna, Q may be expressed in terms of the...
- 104
- 329
- 0
Báo cáo y học: "The development of the Quality Indicator for Rehabilitative Care (QuIRC): a measure of best practice for facilities for people with longer term mental health problems" potx
Ngày tải lên :
11/08/2014, 16:23
... measure of this type and has potential for use as a research tool and as an international quality benchmark Additional material Additional file 1: Results of inter-rater reliability testing Acknowledgements ... pilot data in each centre clarified any coding queries Double data entry was completed for 10% of the toolkit data using a separate database and the study statistician carried out data validation ... any domain Based on this third iteration a final allocation of items to domains was produced The reliability of these domains was assessed using two measures: 1) the KMO measure of sampling adequacy...
- 7
- 274
- 0
Báo cáo y học: " Assessment of FIV-C infection of cats as a function of treatment with the protease inhibitor, TL-3" pot
Ngày tải lên :
13/08/2014, 13:20
... used for real-time PCR are as follows: FIV reverse-transcriptase forward: 5'-ACTGAACCTGACCGTACAGATAAATTACAGGAA GAACCCCCATA -3' FIV reverse-transcriptase reverse: 5'-TGTTAATGGATGTAATTCA TAACCCATC -3' ... N-terminal of the protease and 3' primer MFIVCPL 33' (5'-CTGAGATCTGAGCAAGCTTTTACATTACTAATCT AATATTAAATTTAACCATG TTATC -3' ), which adds a stop codon and a Hind III restriction site to the C-terminus of ... used as a template for PCR reactions using 5' primer MFIVCPL5' (5'-GATTTATAAATCATATG GCATATAATAAAGTGGGTACCACTACAACATTAG -3' ), which adds an NdeI restriction site, methionine, and alkaline to the...
- 12
- 323
- 0
Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx
Ngày tải lên :
13/08/2014, 16:21
... i is an indicator which assumes the value zero for the control case, i.e radiation alone, and one for the drug-treated case; and δx – where "x" is any of the parameters above – is the variation ... but the method has limitations Results Firstly, the fitting of these models has always been performed separately on the treated and untreated datasets, making direct comparison of the parameters ... The main features of the method are the inclusion of an indicator term in the model to indicate the presence of the drug and a factor δx representing the variation on any parameter of survival...
- 7
- 320
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic ... presence of EDTA The rough S minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and ... LPSs, the effect of EDTA was to reduce the oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of...
- 6
- 748
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
Ngày tải lên :
23/03/2014, 13:20
... of 3. 0 mm for the dissociation constant [31 ] Glyoxalase I reaction was started by the addition of yeast Glx I The formation of SDL-TSH was followed at 240 nm, and its concentration was calculated ... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... concentration 238 9 The glyoxalase pathway in Leishmania infantum M Sousa Silva et al A B Fig The glyoxalase pathway in Leishmania infantum Reactions and correspond to the nonenzymatic (n.e.) formation...
- 11
- 515
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
Ngày tải lên :
20/06/2014, 15:20
... relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of ... significant, and 0,05 < p < 0.10 as a trend To test the impact of several variables on the SpREUK sub-scales, we performed analysis of univariate variance (ANOVA) All statistical analyses were performed ... on the technique of factor analysis, which examines the correlations among a set of variables, in order to achieve a set of more general "factors." VARIMAX -factor analysis was repeated rotating...
- 11
- 425
- 0
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
Ngày tải lên :
07/08/2014, 14:20
... to increase the accuracy of the measurement because a lower speed would have increased the fluctuation of the viscosity readings A temperature controller (temperature accuracy of ±1°C) was used ... to this research They are: Ms Azira Amran, Mr Mahmood Sulaiman, Mrs Siti Zalaikhar, Mr Rozimi and Ms Mazalina Viscosity as a Function of Absolute Temperature 38 REFERENCES Fasina, O O & Colley, ... Universiti of Malaya, NTC, Kuala Lumpur, 4–5 May 2009, 58–65 Magerramov, M A. , Abdulagatov, A I., Abdulagatov, I M & Azizov, N D (2007) Viscosity of tangerine and lemon juice as a function of temperature...
- 10
- 496
- 1
Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx
Ngày tải lên :
11/08/2014, 16:22
... adult male, adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for ... of the study, and participated in its design and coordination and drafted the manuscript RB carried out the field work, assisted in data analysis and assisted in drafting the manuscript All authors ... files and the official records in the Offenders Index of the Home Office A reconviction was regarded as being “serious” in cases of murder, manslaughter, assault, rape, indecent assault towards adult...
- 8
- 388
- 0
top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern
Ngày tải lên :
22/12/2014, 22:04
... models, so that a comparison of the measurements and searches in data and simulation can be used to test proposed extensions of the Standard Model A comparison of the data and the simulated result ... dynamically generates their mass The interaction terms between the Higgs boson and the matter fields are added in the Yukawa sector of the Lagrangian Note as well that the gauge bosons have their ... transformation and can be written The symbol T in the superscript indicates that the transverse of the matrix is to be taken 2.1 The Standard Model 10 as T a = σ a (where σ a are the Pauli matrices);...
- 251
- 712
- 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
Ngày tải lên :
30/09/2015, 16:58
... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... rationale vs no rationale categories 110 Figure 14: Comparison of average CARs of rationale vs no rationale categories 111 Figure 15: Comparison of average AREs by primary rationale and overall 115 ... Sample by Average Two-Year Growth Rate in Revenues 191 Table A1 9: ARE and CAR Means and Standard Deviations for Various TwoYear Average Growth Rates in Revenues 192 Table A2 0: Listing of Companies...
- 217
- 227
- 0
The muslim religious elite in contemporary malaysia a study of dominant ideas and orientation of prominent religious personalities and their impact
Ngày tải lên :
16/10/2015, 12:00
... Non‐Government Organizations Pertubuhan Kebajikan Islam Malaysia Persatuan Ulama Malaysia Secretariat for Asia Assembly of Ulama Sisters in Islam Parti Islam Se Malaysia (Islamic Party of Malaysia) Universiti Kebangsaan Malaysia (National University of ... Universiti Kebangsaan Malaysia (National University of Malaysia) Universiti Malaya United Malays National Organization University Pertahanan Nasional Malaysia (National Defence University of Malaysia) ... PAS have been elected as Heads of Fatwa in Malaysia are legally binding once they are gazetted and can be enforced as law of the state. Due to the Malaysian federal system, a fatwa can be issued at the federal level by the National Fatwa ...
- 211
- 1.2K
- 0
Báo cáo khoa học: "THE TEXT SYSTEM FOR NATURAL LANGUAGE GENERATION" doc
Ngày tải lên :
17/03/2014, 19:21
... attributes, and based database attributes kind of data you have? All entities in the (INR database have DB attributes R~MARKS There are types of entities in the ONR database: destructive devices and ... another type of system (such as a tutorial system, for example) The semantics are not particular, however, to the domain of the database When transferring the system from one database to another, ... a greater LENGTH than all other ships and a " greater DISPLACEMENT than most other ships 3) Mine warfare ships, for example, have a DISPLACF24ENT of 32 0 and a LENGTH of 144 4) All aircraft carriers...
- 8
- 272
- 0
Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx
Ngày tải lên :
09/08/2014, 07:21
... of celiac artery was defined as CAD The distance of a horizontal plane at a right angle to CAD was defined as CATD CAD and CATD were measured on CT at the level of the root of the celiac artery ... intraabdominal complication such as anastomotic leakage or POPF In case of having intraabdominal infectious complication, we changed drains under radiographic examination and lavaged the cavity ... carried out collection of data, and NY drafted the manuscript TO and YR participated in the design of the study and performed the statistical analysis CK and TI conceived of the study, and participated...
- 7
- 385
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
Ngày tải lên :
13/08/2014, 13:22
... of low back pain had been classified as being overweight [19] This basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index ... that more than 50% of adult Americans have a BMI equal to or greater than 25 [ 23] Although there are certain limitations to BMI i.e large muscular athletes who are in good cardiovascular shape, ... that patients with a BMI of greater than 40 are at a high risk of developing low back pain Albeit controversial, Table may lead to a further refinement of risk of osteoarthritis and low back pain...
- 6
- 402
- 0
Tài liệu The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice Second Edition pptx
Ngày tải lên :
15/02/2014, 02:20
... of cer, and I would like publicly to thank him and Paula for their service and sacrifice for all of us And for Barbara To my sons, Ryan and Jason, and stepsons, Glenn and Chandler, you have my thanks ... counseling either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many practitioners: a way to schedule appointments or answer ... state licensing board Practice Implications An awareness of your personal moral code in relation to knowledge of the professional standards and regulations of your state and national associations...
- 577
- 4.7K
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
Ngày tải lên :
22/03/2014, 11:20
... figures for 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations ... technology and associated costs, and the increasing perception of health as a business All of these have contributed towards increasing privatisation of health care services in general and in home care ... Decline of the welfare state Teeple [11] sees increasing income and wealth inequalities and the weakening of social infrastructures within Canada and elsewhere as resulting from the ascendance of...
- 17
- 843
- 0
Đề tài " The Tits alternative for Out(Fn) II: A Kolchin type theorem " pot
Ngày tải lên :
22/03/2014, 20:20
... G) Applying the statement of the lemma to {Ak } we learn that for all large k there is a lift Ak of Ak that terminates at y For infinitely many k, Ak starts at x, and {Ak } forms a polynomial ... that {Ak } is the concatenation of {A1 ,k } and {A2 ,k } where both {A1 ,k } and {A2 ,k } satisfy the inductive statement, and at least one of {A1 ,k } and {A2 ,k } is not short Let A be the eventual ... critically important to understand the behavior of paths under iteration by f If a path splits, the behavior of the path is determined by the behavior of the subpaths 3. 3 Relative train tracks and...
- 60
- 341
- 0
The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice pot
Ngày tải lên :
23/03/2014, 06:20
... of cer, and I would like publicly to thank him and Paula for their service and sacrifice for all of us And for Barbara To my sons, Ryan and Jason, and stepsons, Glenn and Chandler, you have my thanks ... counseling either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many practitioners: a way to schedule appointments or answer ... state licensing board Practice Implications An awareness of your personal moral code in relation to knowledge of the professional standards and regulations of your state and national associations...
- 577
- 2.5K
- 0