2′ deoxyribose oxidation chemistry as a function of the oxidant

A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation

... Disadvantages of Microstrip Antennas It is actually the last advantage in the list above that makes microstrip antennas so popular today Many characteristics of a single microstrip patch antenna ... every façade of antenna communications From the battle field to commercial enterprises, the microstrip antenna is fast replacing many conventional antennas The advantages and disadvantages of the ... 5.1: Samples of antennas fabricated for measurements of Variation in the “d” parameters 75 Figure 5.2: One of the two antennas (Antenna A & B) fabricated for angular variation measurements Figure...

104
329
0

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Danh mục: Báo cáo khoa học

... reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not inﬂuenced by pH The biphasic reaction was shown ... general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a chains The rates of oxidation are ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the...

6
748
0

top-antitop cross section measurement as a function of the jet multiplicity in the final state and beyond the standard model top-antitop resonances search at the atlas detector at cern

Danh mục: Tổng hợp

... dynamically generates their mass The interaction terms between the Higgs boson and the matter fields are added in the Yukawa sector of the Lagrangian Note as well that the gauge bosons have their masses ... compared to the other particles in the Standard Model It belongs to the classification of a “quark” in the Standard Model, of which there are six flavours An interesting effect of the fact that quarks ... predicts a resonance decaying in a top-antitop pair, using ATLAS data at center -of- mass √ energy of s = TeV The latter analysis is repeated for ATLAS data col√ lected with s = TeV Performance studies...

251
712
0

Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided

Danh mục: Tổng hợp

... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other listing ... 204.16 The notice to the exchange should be provided as soon as possible after the declaration date and preferably, at least ten days in advance of the record date Among other items, the notice...

217
227
0

Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot

Danh mục: Điện - Điện tử

... chemistry of the samples First, the contact angle of water was measured as a control on a clean (as defined in experimental section) silicon substrate and was 36.0° The contact angle of water was determined ... 25°C and the heating process was repeated for a second run All of these tests used nitrogen as a purge gas The glass transition function in TA Instrumental Analysis was used to calculate the Tg of ... beam that holds the tip, thus maintaining constant amplitude of oscillation as the surface height changes A laser beam records the deflection of the cantilever beam as the tip rasters along the...

80
375
0

Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Danh mục: Điện - Điện tử

... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...

5
310
0

báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx

Danh mục: Hóa học - Dầu khí

... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...

5
365
0

Danh mục: Báo cáo khoa học

... to increase the accuracy of the measurement because a lower speed would have increased the fluctuation of the viscosity readings A temperature controller (temperature accuracy of ±1°C) was used ... who have indirectly contributed to this research They are: Ms Azira Amran, Mr Mahmood Sulaiman, Mrs Siti Zalaikhar, Mr Rozimi and Ms Mazalina Viscosity as a Function of Absolute Temperature ... Malaya, NTC, Kuala Lumpur, 4–5 May 2009, 58–65 Magerramov, M A. , Abdulagatov, A I., Abdulagatov, I M & Azizov, N D (2007) Viscosity of tangerine and lemon juice as a function of temperature and...

10
496
1

Báo cáo khoa học: "Regional distribution of acoustic-based lung vibration as a function of mechanical ventilation mode" docx

Danh mục: Báo cáo khoa học

... total area was due to the expansion of the lower lung region whereas areas in the upper and the middle regions decreased (Table 3) Assessment of relative percentage changes in areas revealed an ... in the lungs: image analysis and raw numerical data calculation In contrast to image analysis, the numerical method was not affected by normalization The correlation of vibration energy and airflow ... vibration energy are represented as black in a gray-level scale and the areas with the lowest vibration energy are represented as light gray Areas of a frame are white if their energy is below a...

13
310
0

Báo cáo y học: " Assessment of FIV-C infection of cats as a function of treatment with the protease inhibitor, TL-3" pot

Danh mục: Báo cáo khoa học

... (cDNA) was synthesized from isolated plasma viral RNA of infected cats The cDNA pool was used as a template for PCR reactions using 5' primer MFIVCPL5' (5'-GATTTATAAATCATATG GCATATAATAAAGTGGGTACCACTACAACATTAG-3'), ... GCATATAATAAAGTGGGTACCACTACAACATTAG-3'), which adds an NdeI restriction site, methionine, and alkaline to the N-terminal of the protease and 3' primer MFIVCPL33' (5'-CTGAGATCTGAGCAAGCTTTTACATTACTAATCT AATATTAAATTTAACCATG ... Viremia +TL3 -TL3 Peak Viremia Asymptomatic Symptomatic 10 12 Peak Viremia Average *p < 0.05 Figure Plasma viral loads of FIV infected cats as a function of TL-3 treatment and disease Plasma viral...

12
323
0

Báo cáo y học: "Changes in regional distribution of lung sounds as a function of positive end-expiratory pressure" potx

Danh mục: Báo cáo khoa học

... has been accepted to date The first step in the evaluation of a new approach is to assess if a change in PEEP induces any change in the measurement The aim of the present study was to evaluate ... to the recording procedure, Figure An example of acoustic data as displayed for a recording obtained from aa77-year-old male with myasthenia gravis A representative peak-inspiratory data as displayed ... sound in the apical areas and a smaller ratio increased sound in the diaphragmatic areas Distribution was considered more heterogeneous if the difference was larger than two; this threshold was derived...

10
531
0

Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx

Danh mục: Báo cáo khoa học

... i is an indicator which assumes the value zero for the control case, i.e radiation alone, and one for the drug-treated case; and δx – where "x" is any of the parameters above – is the variation ... flasks was calculated in the usual way For drug-treated flasks, surviving fraction was calculated using the mean, unirradiated, drug-free plating efficiency as the denominator This method revealed ... The main features of the method are the inclusion of an indicator term in the model to indicate the presence of the drug and a factor δx representing the variation on any parameter of survival...

7
320
0

Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx

Danh mục: Báo cáo khoa học

... nitrogen and triglycerides In addition, an enzymatic activity for the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, ... approved the final manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a table detailing the histopathological ... amount and quality of the cRNA was assessed using a NanoDrop ND-1000 spectrophotometer and an Agilent Bioanalyzer The cRNA was then fragmented and hybridized to the Rat Genome 230 2.0 Array (Affymetrix,...

13
284
0

computational and experimental analyses of transcriptional regulation as a function of dna sequence

Danh mục: Tiến sĩ

...

183
185
0

Cardiovascular responses as a function of ethnicity, gender, 5HTTLPR genotype, dispositional anger and negative affect

Danh mục: Tổng hợp

... ambulatory cardiovascular activity on the basis of their demonstrated effects on acute cardiovascular responses in the laboratory as well as their hypothesized associations with disease risk Given the ... separate data entry and therefore reduced data transcription errors The Spacelabs and AIM units along with the Palm Zire PDA were placed in a fanny-pack that was worn around the participant’s waist ... classification was made on the basis that both participants’ parents belong to the same ethnic group Characteristics of the sample and means and standard deviations for person-level variables are...

143
202
0

Reading Theory as a Microcosm of the Four Skills

Danh mục: Tư liệu khác

... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...

5
680
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Danh mục: Báo cáo khoa học

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineuroﬁlament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...

14
416
0

krafft carl - gravitation is a function of the aether vortex proton

Danh mục: Điện - Điện tử

...

9
292
0

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

Danh mục: Hóa học - Dầu khí

... promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed ... Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another health condition diagnosed by a health professional that had ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...

11
619
0

Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

Danh mục: Báo cáo khoa học

... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... analyzed the patient data and wrote the manuscript CdG interpreted the data regarding cornual pregnancy and was a major contributor in writing the manuscript Both authors approved the final manuscript ... she was afebrile There was slight tenderness in her right lower abdominal quadrant No guarding or rebound tenderness was noted, and no abdominal mass was palpable Laboratory findings were: quantitative...

4
341
0