2008 reconciling the chemistry and biology of reactive oxygen species nat chem biol 4 278 286

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08

... tyrosine and other phenolic metabolites and xenobiotics and gluthionyl radical (GS•) are generated from other thiols such as cysteine residues Figure modified from Nature Chemical Biology (2008) 4: 278 ... dehydrogenase (KGDH) 144 4. 1 .4 Summary 146 4. 2 Toxicoproteomics of Troglitazone-induced Mitoproteome Alterations 148 4. 2.1 Introduction 148 4. 2.2 Mitochondrial proteome ... mitoproteome 137 4. 1.3.1 Redox proteins 140 v 4. 1.3.2 OXPHOS 141 4. 1.3.3 Urea cycle 143 4. 1.3 .4 β-Oxidation 144 4. 1.3.5 α-ketoglutarate...

226
1.8K
0

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Ngày tải lên : 19/02/2014, 13:20

... coagulattion J Biol Chem 2 64, 47 43– 47 46 Kalafatis, M., Rand, M., D., Mann, K & G (19 94) The mechanism of inactivation of human factor V and human factor Va by activated protein C J Biol Chem 269, ... facilitated the determination of loss of FVa cofactor activity during the initial stage of inactivation and minimized the inﬂuence of the k306 Ó FEBS 20 04 Heparin and APC-catalyzed inactivation of FVa ... investigation of the interaction between APC and FVa However, given the general abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations...

13
654
0

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20

... sensitive to the chemical nature of the axial ligands to the hemeiron [41 ] Upon replacing the native Met ligand with either an exogenous or protein-based ligand a change in the distribution of the unpaired ... deviations are detected at the start of the ligand loop, the largest changes are observed in the region between the amide nitrogen of K100 and the amide nitrogen of L1 04 (Fig 4C) This movement results ... addition of chemical denaturants [12,13] Table Main-chain torsion angles for part of the ligand loop of wt ferricyt c-550, the M100K(rt) structure and the two conformers, A and B, of the M100K(cc)...

15
509
0

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Ngày tải lên : 08/03/2014, 16:20

... receptor sequences Microbiology 145 , 144 3± 145 1 24 Fieser, L.F & Ourisson, G (1953) Cholesterol and companion IV Oxidation of D7 sterol with selenium dioxide J Am Chem Soc 75, 44 04 44 14 25 Mancini, A., ... D7-reductases, respectively, and 44 % to S cerevisiae sterol D 24( 28)-reductase] The EFGGx(2)G signature of sterol D 24( 28)-reductase and D 14- SR and the LLxSGWWGx(2)RH signature of sterol reductases family ... encoding a protein of 41 8 amino acids with a calculated molecular mass of 46 751 Da The N-terminal amino-acid sequence of the protein puri®ed from liver and the amino-acid sequence of the 19.5kDa fragment...

8
493
0

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel ﬂuorescent probe pdf

Ngày tải lên : 16/03/2014, 11:20

... correlation between the ﬂuorescence intensity and O2–Æ concentration To assess the selectivity of the method, the effect of other ROS and biological compounds on the determination of 3.33 lm O2–Æ ... the optimum reaction conditions for the analysis of O2–Æ, the effect of buffer solution and the concentration of the ﬂuorescent probe were investigated Effect of pH and buffer concentration The ... spectra of DBZTC and DBZTC oxide were analyzed As shown in the H NMR spectra of DBZTC oxide, peaks corresponding to N–H (4. 5) and C–H (4. 0) disappeared, and in the IR spectrum, N–H (3 245 cm)1) and...

9
401
0

Báo cáo khoa học: Identiﬁcation of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Ngày tải lên : 23/03/2014, 11:20

... located in the core of the CCP structure (Fig 3A) Furthermore, all of the additional insertions of the extended MCA2590 sequence are introduced in loop regions on the surface of the structure, thereby ... Detection of C-type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary sequence, it was of interest ... MopB and MopE in the 6328 A B Fig SDS ⁄ PAGE (A) and protein immunoblot analyses (B) of proteins obtained during the fractionation of M capsulatus Samples of each step during the fractionation...

12
392
0

Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Ngày tải lên : 07/08/2014, 20:23

... .nim 01 rof Co27 ta noisnetxe lanif dna nim rof Co49 ta noitarutaned laitinI ces 54- Co27,ces 03-Co85 ,nim 3-Co49 selcyc 03 :4 ;ces 06 -Co27,ces 06-Co06 ,ces 06-Co49 selcyc 03 :3 ;ces ... lonaporposi htiw detatipicerp saw AND )1 : 42 ( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb ... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG...

4
138
0

Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Ngày tải lên : 20/01/2014, 22:20

... Intelligent Service Development and Implementation LaoNet(Korea) & Univs in Korea, A Study on the Construction of the MPLS Testbed(L-bone) on KOREN and the Development of the MPLS Application Services ... Background  Cooperation Between EU and Asia After the Cold War, the int’l society became tri-polar with US, Europe and Asia >> In 1996, resulted in the establishment of the Asia-Europe Meeting (ASEM) ... exchanges and cooperation between Asia and Europe through increased and more effective information flows; b) Enhance and diversify research exchanges and cooperation between Asia and Europe; c) Expand...

30
362
0

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Ngày tải lên : 16/03/2014, 18:20

... whether the plasmodial size (growth rate, Fig 2A,C,E) and the duration of the cell cycle (Fig 2B,D,F) depended on the dose of injected PMLA, over the range 0 40 0 lg PMLA (A–D) The times of the ... changes in the levels of PMLA in cytoplasm and nuclei, we injected 40 0 lg of the polymer into M3CVII and LU887 plasmodia (weights of 150 mg) and measured the PMLA contents of nuclear and cytoplasmic ... following the second mitosis Sizes of plasmodia were then of the order of 4 7 cm2 The third metaphases were observed at 25.6 ± 0.5 h (mean ± SD, 10 replicates) after the fusion of microplasmodia for the...

7
325
0

Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Ngày tải lên : 23/03/2014, 06:20

... (.57-.59) 65 (. 64- .67) 53 (.52-.55) 63 (.62-.65) 43 ( .40 - .46 ) 70 (.66-. 74) 2533 (2337-2729) 15.2 (13.1 - 17.2) 59 (.57-.60) 66 (. 64- .69) 54 (.52-.56) 64 (.63-.65) 44 ( .40 - .47 ) 69 (. 64- . 74) Average ... 7) The magnitude of the prenatal and child care process quality coefficients increase slightly with the omission of the structural quality measures in Models and 6, and the prenatal process care ... D.A., 19 94 Relation of the content of prenatal care to the risk of low birth weight Maternal reports of health behavior advice and initial prenatal care procedures Journal of the American Medical...

53
369
0

Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the ﬂounder Platichthys stellatus pptx

Ngày tải lên : 29/03/2014, 08:20

... June 20 04, issued October 20 04 Am J Infect Control 32, 47 0 48 5 39 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 40 O’Farrell ... equilibrated previously with the same buffer, and the column was then washed with the buffer The ﬂow rate of the column was 30 mLÆh)1 and the fraction volume was 10 mL The protein concentration ... equilibrated with the same buffer, and the column was then washed with the buffer The ﬂow rate of the column was mL ⁄ and the fraction volume was mL Proteins were eluted stepwise from the column using...

13
423
0

The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

Ngày tải lên : 28/06/2014, 17:20

... carrying on the war In the last analysis this amount must be paid out of the past savings and the savings from current earnings of the people of the United States The wealth of the nation consists ... maintain prices at the higher level, and so far as he buys additional commodities, he increases the demand for them and tends further to advance the price level If, on the other hand, the worker will ... in the right direction and he tends to reach the point of relative competence, of independence in his pecuniary affairs Preëminent in the class of the thrifty we think of the man of affairs; the...

109
350
0

The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

Ngày tải lên : 28/06/2014, 19:20

... Cleveland bay, Belfounder Eclipse, American points of habits breeding management of colts breaking longevity, feeding Diseases glanders 140 142 143 143 144 145 141 146 147 148 149 150 151 1 54 1 54 ... in the year 1 847 By RICHARD L ALLEN, In the Clerk's Office of the District Court of the United States for the Southern District of New York INTRODUCTION The object of the following work, on the ... knowledge of the best mode of breeding and management is of still higher importance The first will enable the breeder to preserve the high character of the animals in his hands, or perhaps still farther...

794
2.7K
0

Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx

Ngày tải lên : 07/08/2014, 10:21

... 151 .40 188.33 ± 60 .47 6.92 ± 0.92 14. 40 ± 1.77 Jeseník H Ae/Ep 3.76 ± 0.09 3 .43 ± 0.16 3.22 ± 0.18 3.16 ± 0.11 42 00 ± 4. 00 30.50 ± 28.50 926.00 ± 57.00 146 .00 ± 45 .00 4. 58 ± 0.71 16 .45 ± 14. 45 ... ± 41 .12 73.20 ± 30.76 312.20 ± 84. 94 40.20 ± 10 .46 18.20 ± 6.01 Janovice H Ae/Ep Bs 12.20 ± 8.50 9.88 ± 12.68 5.75 ± 2.75 61.20 ± 12 .42 27.25 ± 4. 09 17.00 ± 1.00 2 54. 00 ± 1 94. 44 115.50 ± 27. 14 ... the limit of the lower optimum of 130 mg·kg–1 In the subsequent organomineral horizon (Ae/Ep) the values of Ca indicate the lower optimum reserves in the range of 80–160 mg·kg–1, and in 15% of...

12
529
0

Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf

Ngày tải lên : 08/08/2014, 01:22

... and monocots [19] The introduction of this gene into embryogenic cultures of forest species may therefore be a potent mechanism for introduction of stress tolerance into forest species, and their ... of proline on the specific growth rate of larch (Larix leptoeuropaea Dengler) embryogenic cultures at °C and 24 °C Mean values ± the standard error of the mean (SEM) are shown 2 .4 Proline assay ... protected the cells from the effects of the salt, cold and freezing stresses applied and in a similar manner to that of herbaceous, deciduous angiosperms This raises the possibility that forest species...

4
338
0

Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps

Ngày tải lên : 08/08/2014, 18:21

... were observed in the upland and solonetz stands, and the lowest in the floodplain and riverbank stands Since the crowns are more frequently damaged by insects in floodplain stands, these latter have ... collected during autumn 1980 and 1990 from the northern and southern sides of the stems at 1.3 m The width of the 30 last annual rings was measured (± 0.05 mm), and latewood (LW) distinguished ... with the exception of the Solonetz stand, were it was similar in early- and latewood; iv) the relationship between radial increment and a single defoliation was much closer in the upland and...

6
263
0

Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Ngày tải lên : 08/08/2014, 19:21

... photochemical efficiency, the balance between the increase in thermal deexcitation and the reduction status of the pool of primary electron acceptors (Q ) A was similar in the species tested, and ... photosynthesis in four species of the hickory forest type For Sci 24, 73- 84 oak- G, Weis E (1991) Chlorophyll fluores- cence 615-625 photosynthesis: the basics Annu Physiol Plant Mol Biol 42 , 313- 349 ... Comparisons of photosynthetic responses of XanBahari ZA, thium strumarium and Helianthus annuus to chronic and acute water stress in sun and shade Plant Physiol 84, 47 6 -48 2 Björkman O, Powles SB (19 84) ...

13
402
0