2003 altered localization and activity of the intracellular tyrosine kinase brk sik in prostate tumor cells oncogene 22 27 4212 20
Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc
... Structure and activity of the Rio1 kinase two lobes which sandwich ATP and contains the catalytic loop, the metal-binding loop, and the nucleotidebinding loop (P-loop, glycine-rich loop), but lacks the ... neither the presence of the c-phosphate nor autophosphorylation (Fig 4A) The flexible loop and hinge region of the Rio1 kinases The loop between aC and b3 of the RIO kinase domain shows distinct ... which interacts with the c-phosphate and is not seen in tyrosine kinases This residue is replaced by a serine in all Rio1 kinases and by serine or aspartic acid in all Rio2 kinases, and the c-phosphate...
- 16
- 315
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... to the agar medium in agreement with low cellular PKA activity On the other hand, S 1278 b wild-type control cells showed the normal, strong invasive growth In fact, the extent of the reduction of ... 271 ) 1291 Colavizza, D & Thevelein, J.M (1998) Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae ... drastically diminished sporulation efficiency and, thus, mimics a phenotype of increased PKA activity in S 1278 b wild type and slightly less in Dras2 cells While the deletion of SUT2 in wild-type cells...
- 8
- 485
- 0
Báo cáo sinh học: " Chromosomal localization and activity of nucleolar organizer regions in the dog" pot
... made the development of the physical mapping of the canine genome possible The objective of the present study was the chromosomal localization of NORs in the dog karyotype and the analysis of their ... in the terminal part of the q arm, belongs to a group of small autosomes not yet included in the canine standard karyotype The banding pattern of this chromosome is shown in figure 1A In the ... 1) and on the Y chromosome The Q-banding pattern indicated that NORs were localized in the terminal part of the q arms of chromosome pairs: and 17 The third chromosome pair, also bearing NORs in...
- 6
- 285
- 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... not contain the central region or the 5¢ end of the gene The cosmid clone containing the longest part of the new gene was named CAR1 and studied The 1719 probe and a cDNA probe (1 820) obtained by ... exposure of ligand-binding sites outside of the cell To date, no ligand has been identified for MUC3 but SMC has been shown to bind the erbB2 receptor tyrosine kinase through one of the EGF-like domains ... organization of MUC4 we determined by comparison of the published cDNA and the evolving human draft sequence [20] is very close to that of the mouse Muc4 (Table 1) The size of intron of the human...
- 10
- 434
- 0
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells
... formation of these polymer aggregates As can be seen, the thermally induced polymerization of styrene, as well as the blending of PS and SPS polymers, causes reduction in the remaining pores of the PVDF ... continuously swells and decomposes The swelling is due to the degradation of the cross-linking structure of the membrane in the H2O2 solution [33] The decomposition rate is larger than the swelling effect ... Plant (Shanghai, China) The PVDF composite membrane was made in our laboratory using a combination technique of thermally induced polymerization and phase inversion, and all of the other reagents...
- 14
- 596
- 1
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... stromal cells J Biol Chem 269, 3273 2– 3273 9 Li R, Hartley L & Robb L (200 1) Cloning of rat interleukin 11 and interleukin 11 receptor alpha chain and analysis of their expression in rat uterus in the ... and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the ... RT–PCR in all the tissues examined, with apparent high levels of expression in intestine and gills Intestine and gills are two primary sites where fish encounter foreign insults including infection...
- 12
- 511
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... fraction of LAT, CD4 and CD8 in T cells, CD44 in various cell types or in uenza virus haemagglutinin in epithelial cells) [14] Thus, the present study aimed at investigating whether the molecular ... results in heterodimerization of the intracellular domains of b and cc chains followed by association with Jak, Syk (or src family) kinases These, in turn, phosphorylate the receptor chains, forming ... immunoblotting The major tyrosine- phosphorylated bands appeared in the 35– 60 kDa region and the extent of phosphorylation increased in time, plateauing in % 15 after IL-2 addition The right panel of...
- 10
- 499
- 0
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... http://www.hqlo.com/content/6/1/113 and input into the manuscript IG wrote the manuscript As the developer of the MOS-Sleep, RDH helped in the interpretation of findings and reviewed the manuscript Acknowledgements ... any of the others Construct validity was tested with the following two analyses The ability of the MOS-Sleep scores to discriminate between groups of subjects according to the severity of the ... 0.0% in South Africa and the United Kingdom to 1.5% in Germany at baseline (V1) and from 0.0% in Hungary to 1.6% in the United Kingdom at termination visit (V6) Psychometric properties of the...
- 12
- 553
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... of the insulin-treated patients agree to the item that injecting insulin is painful, compared to 43% in the insulin-naïve group This suggests that despite improved injection devices and thinner ... sickness Insulin will make life less flexible Fear of needle injection Insulin will increase the risk of hypoglycaemia Insulin will improve health Insulin will cause weight gain 10 Insulin will...
- 7
- 602
- 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf
... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrassing 14 Injecting insulin is painful ... of the insulin-treated patients agree to the item that injecting insulin is painful, compared to 43% in the insulin-naïve group This suggests that despite improved injection devices and thinner ... sickness Insulin will make life less flexible Fear of needle injection Insulin will increase the risk of hypoglycaemia Insulin will improve health Insulin will cause weight gain 10 Insulin will...
- 7
- 485
- 1
Báo cáo hóa học: "Research Article Probabilistic Localization and Tracking of Malicious Insiders Using Hyperbolic Position Bounding in Vehicular Networks" pot
... as the intersection of the hyperbolic areas constructed from all receiver pair combinations within that subset The final candidate area for a transmitter consists of the intersection of the intermediate ... using the allpairs approach within the subset, and yields an ultimate candidate area for a transmitter as the intersection of the receiver subset intermediate candidate areas Let R be the set of ... scenario and assess the success in tracking it by measuring the distance between the actual and estimated positions, in addition to the difference between the approximated direction of travel and the...
- 13
- 303
- 0
characterization of signaling pathways and significance of the axon guidance molecule plexin b3 in glioma progression
... the PDZ domain of LARG is directly involved in the interaction with the C-terminus of plexin-B1 Mutation of either the PDZ domain in LARG or the PDZ binding site in plexin-B1 eliminates the interaction ... 120 3.4.3 Identification of fascin-1 binding regions in the intracellular domain of plexin-B3 122 3.4.4 Identification of CIPP binding regions in the intracellular domain of pleinx-B3 ... proteins such as talin, vinculin, and ERM (ezrin, radixin, moesin) actin-binding proteins, act as linker proteins to connect the cytoplasmic domains of integrins to the cytoskeleton, resulting in...
- 286
- 266
- 0
Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc
... SH3 domain of the Src-family kinase, Hck, is reported as one of the strongest interactions between an SH3 domain and its ligand (KD = 250 nM) [12], results in activation of the kinase and has ... domain I of NS5A was not involved in interactions with the SH3 domain, however we cannot rule out the possibility that domain I might mediate interactions with the intact kinase Interestingly, the ... to the binding energy of the NS5A-SH3 domain interaction To test this hypothesis we constructed the corresponding site-directed mutants of the Fyn SH3 domain in the context of a GSTFynSH3 domain...
- 9
- 447
- 0
Báo cáo y học: "Anti-Inflammatory mechanisms of the proteinaseactivated receptor 2-inhibiting peptide in human synovial cells" ppt
... minutes, or in combination with adding PAR2-IP first for 30 minutes and then trypsin for another 30 minutes The relative levels of p-p65 were calculated by normalizing the band densities to that of GAPDH ... trypsin-digested N-terminal PAR-2, and they bind to the same region of PAR2 [10,34] In other words, PAR2-AP is able to bind trypsin, however, without interference on its activity Indeed, PAR2-AP and ... Although there could be a concern of trypsin-induced cell death, similar conditions were used in other studies [13,33] no sign of increased protein degradation in cells treated with trypsin, and the...
- 9
- 381
- 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... domain-only proteins are a subfamily of the Bcl-2 family involved in the initiation of apoptosis through the mitochondrial pathway The key event in the mitochondrial pathway is the release of ... [25] We therefore sought to determine if there could be a link between EGF-induced reduction in Bid and tBid levels and the ubiquitin ligase activity of Itch In this study, we first examined the ability ... produced (Fig 1D, lane 2) In the presence of lactacystin, a significant increase in the amount of tBid–GFP present in the extract, both in control conditions and in the presence of FLAG–Itch, was observed...
- 12
- 718
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... The modes of binding of E-64 with ervatamin-A and ervatamin-C have been analyzed and compared with the structures of other complexes of the same family E-64 binds to these two ervatamins in the ... On the other hand, the P3 moiety of E-64 in each of the of the two ervatamin-C molecules in the asymmetric unit mainly interacts with His61 in both molecules (Fig 2B) The substrate specificity of ... for this class of enzymes is at the interface of the two domains, interdomain plasticity plays a role in the activity of the enzyme In the case of ervatamin-A, polarizibility and active site...
- 14
- 634
- 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx
... al split tyrosine kinase (TK) domain Binding of of the 22 fibroblast growth factor (FGF) ligands in the presence of cell-surface heparan sulfate proteoglycans acting as coreceptors, induces receptor ... the K650M mutant The kinase activity of FGFRs, including FGFR3 [37,38], is inhibited by SU5402, which binds to the kinases’ ATP-binding site [39] We therefore determined whether SU5402 prevented ... suggesting that most of the receptor was present in the ER Costaining with calnexin (another marker of the ER) and Ptyr antibodies gave similar results (not shown) Colocalization of FGFR3 and the...
- 16
- 573
- 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx
... N-linked oligosaccharide side-chains are important for the GABA transport activity 1-Deoxymannojirimycin inhibits the GABA-uptake of GAT1 In order to gain further insight into the role of the ... misfolding of this protein, resulting in its partial retention in the ER and its rapid digestion thereafter [16,19] Accordingly, our results indicate that the intracellular trafficking of N-glycosylation ... using iplabgel software The total protein of the cell surface and intracellular bands of each wild type or mutant were set at 100% G Cai et al tants using streptavidin beads (see above) The intracellular...
- 14
- 654
- 0
Báo cáo khoa học: Solution and membrane-bound chaperone activity of the diphtheria toxin translocation domain towards the catalytic domain" doc
... translocation, the C domain and only the 63 N-terminal amino acids of the T domain are present on the trans side of the membrane [24,25] The remaining 124 amino acids of the T domain are left in the membrane ... unfolding of the C domain in solution (Fig 3) and during binding to the membrane (Fig 4A,C and 5, structural transition C1 and pink arrow) Thus, the T domain favors the interaction of the C domain ... facilitated the insertion of the C domain in the membrane To better characterize the environment of the Trp residues of the C and T domains within CT during the interaction with the membrane,...
- 10
- 337
- 0
UNDER SECTIONS 318 AND 319 OF THE FAIR AND ACCURATE CREDIT TRANSACTIONS ACT OF 2003 docx
... among other things, placing certain legal obligations on creditors and other furnishers of data to the CRAs with respect to the accuracy of the information they provide In 200 3, the FACT Act further ... certain key information, including (1) the identity of the consumer reporting agency from which the creditor obtained the report; (2) the right to obtain a free copy of the report; and (3) the ... account information includes the identity of the creditor, the date the account was opened (and closed, if applicable), whether the account is open and in good standing, the balance and credit...
- 120
- 321
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008