0

2 where the customer has not been physically present for identification purposes a relevant person must take specific and adequate measures to compensate for the higher risk for example by applying one or more of the following measures—

The customer is (not) always king impoliteness in the service encounter

The customer is (not) always king impoliteness in the service encounter

Cao đẳng - Đại học

... Park and Dr Mie Hiramoto, for their invaluable guidance and advice And saving the most special for last, my baby girl, Audrina, this one s for you darling Abstract This thesis serves as a contribution ... encounter, and vice versa – thesaurus.com and Roget’s International Thesaurus A word sketch is a one- page, automatic, corpus-derived summary of a word’s grammatical and collocational behaviour each ... not adequately account for the communicative impact of a particular stance, this thesis will incorporate only the notions of Quality and Social Identity Face and exclude those of Equity and Association...
  • 307
  • 235
  • 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Kỹ năng viết tiếng Anh

... or as a flow chart for children to expand in full prose • a basic text to be elaborated by vocabulary changes and the addition of appropriate phrases, for example to create anticipation and interest ... coordinator of a primary or special school and/ or the appropriate head(s) of department in a secondary school, a member of the school’s senior management team (SMT) or the LA advisory team, or ... affect a learner’s access to learning and limit his or her performance across all areas of the curriculum Low attainers, particularly boys, can become demoralised because of technical and organisational...
  • 174
  • 616
  • 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học

... (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation SDS/PAGE and western ... DNA using the primers PCR_AmiA_EcoRI _for (GGCC GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI _for (GGCCGA ATTCACCATTATGGATCGTAGAC)...
  • 12
  • 445
  • 0
new financial and statistical measures to monitor the success of ge

new financial and statistical measures to monitor the success of ge

Kỹ năng viết tiếng Anh

... 1995 the dividend declared was $1.69 But what does this really mean? Let us take another example Some would say that if for example we offer the 50% or more of the corporation's profit to the stockholders, ... people that closely watch GE's performance, such as creditors and short term investors All of these read our annual reports but at the same time try to find any sort of information about the actions ... possible to keep up with that good name that they have created One can say the effort to that is only related to an attempt, for example, not to create pollution or not to be guilty of any kind of racist...
  • 10
  • 435
  • 0
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt

Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt

Báo cáo khoa học

... cluster formation at IscA1 and the variant C4 4A was compared it appeared that the cluster formation was retarded (data not shown) This demonstrates that the cluster formation at the variant C4 4A was ... NP_440066, Athal1 (Arabidopsis thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053 827 , Athal2 (Arabidopsis thaliana IscA2) AC005 825 .3, Athal3 (Arabidopsis thaliana IscA3), AC006 921 .5, A_ vinIscA ... GCTACC-3¢) and PRiscA 12 (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23 ] cleaved with the...
  • 10
  • 447
  • 0
summary of agricultural doctoral thesis studying the growth, development capacities and technical measures to increase yields, qualities of some exotic orchid cultivars (cattleya, dendrobium, oncidium) for nort

summary of agricultural doctoral thesis studying the growth, development capacities and technical measures to increase yields, qualities of some exotic orchid cultivars (cattleya, dendrobium, oncidium) for nort

Tiến sĩ

... the America and subtropical regions They can be found from Florida to the Bahamas, Caribbean Islands and southern Mexico, Central and South America to Argentina [ 122 ] By studying botanical characteristics ... countries as Netherlands, China, Taiwan, Thailand The above results show that the world has had a lot of research work on orchid plants, in general and on the genera of Cattleyas, Dendrobium and Oncidium, ... Lan Cattleya, Dendrobium , Oncidium orchids are very suitable the climate in Southern areas as of its all - year-round warm weather, great sun radiation and long appropriate sunlight for plant...
  • 27
  • 553
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Sequence analysis of the S1 glycoprotein gene of infectious bronchitis viruses: identification of a novel phylogenetic group in Korea" docx

Báo cáo khoa học

... (5'TG AAAACTGAACAAAAGAC3') together with one of the reverse primers S1OLIGO3' (CTAAACTAACATAAGGG C3') or degenerate3' -2 (5'CCATAAGTAACATAAGGG CAA3') [14,16] The RT reaction for synthesis of cDNA ... bronchitis In: Swayne DE (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 4th ed pp 169-173, American Association of Avian Pathologists, Georgia, 1998 Gharaibeh SM ... isolates using the QIAamp MinElute Virus Spin Kit (QIAGEN, USA) Amplification of the S1 gene by RT-PCR was performed using one of the forward primers S1OLIGO5' (5'TGA AAACTGAACAAAAGA3') or NEWS1OLIGO5'...
  • 7
  • 298
  • 1
Báo cáo toán học:

Báo cáo toán học: "EMILION, a tree functional-structural model: Presentation and first application to the analysis of branch carbon balance" pdf

Báo cáo khoa học

... the ability of a branch to export carbon Figure presents the changes with age in the annual carbon balance CBY of each branch, and the average for all branches The average behaviour of branches ... and SAsun We assumed that SAsun has the same photosynthetic rate as a needle area illuminated by a radiation intensity of Edir/SAsun + Idif , and that SAshade has a photosynthetic rate equal to ... from one branch to another, although there could be some important differences Maximal value of CBY was not reached at the same age for all the branches (4-6) For the same age, the ability of some...
  • 15
  • 256
  • 0
báo cáo khoa học:

báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf

Báo cáo khoa học

... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them ... active, and to ensure there is a history with the physician, patients must have at least one visit between 12 and 36 months prior to the data upload date The EMR data for all remaining physicians are ... using achievable benchmarks for physician feedback: a randomized controlled trial JAMA 20 01, 28 5 (22 ) :28 71 -28 79 32 Sniehotta FF: Towards a theory of intentional behaviour change: plans, planning, and...
  • 10
  • 597
  • 0
báo cáo khoa học:

báo cáo khoa học: " The impact of citrate introduction at UK syringe exchange programmes: a retrospective cohort study in Cheshire and Merseyside, UK" doc

Báo cáo khoa học

... sign rank tests used for matched, and Mann Whitney U for unmatched, data Chi square analyses were used to compare categorical data and all analyses were undertaken using SPSS version 12 [10] or ... that permitted the distribution of citrate also sanctioned the distribution of other injecting paraphernalia (for example, spoons and water), although the distribution of other paraphernalia ... 20 of heroin normally prepared and because packaging a smaller amount would be unfeasible Injectors liked the idea of single use sachets which were also deemed to decrease the risk of contamination...
  • 6
  • 215
  • 0
The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day

The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day

Tổng hợp

... Border Kuala Lumpur Kota Kinnabalu Melaka Pulau Langkawi Singapore Genting Highlands Thailand Hong Kong Kuala Lumpur Thailand Cambodia Thailand Penang Langkawi Kuala Lumpur Singapore Pulau Langkawi ... independence to Dr Mahathir; the Mahathir Years and Mahathir’s Aftermath This both acknowledges the significance of Mahathir to Malaysian political history and sets the context for Chapter four The tourism ... of the Malay language, the Malay royalty and the special position of the Malays out of the political arena.’ Any challenge to these issues was deemed to be treason .20 However, the issue is more...
  • 256
  • 556
  • 0
A balancing act managing financial constraints and agency costs to minimize investment inefficiency in the chinese market alessandra guariglia junhong yang

A balancing act managing financial constraints and agency costs to minimize investment inefficiency in the chinese market alessandra guariglia junhong yang

Kinh tế

... features of the data and descriptive statistics 5.1 The dataset The data used in this paper are drawn from the China Stock Market and Accounting Research (CSMAR) Database and China Center for ... of market value of tradable stocks, book value of non-tradable stocks, and market value of net debt Tobin's Q: ratio of market value of total assets to book value of total assets Return on assets ... (ROA): ratio of net income to total assets Leverage: ratio of the sum of short-term and long-term debt to total assets A Guariglia, J Yang / Journal of Corporate Finance 36 (20 16) 111130 129 Cash:...
  • 20
  • 702
  • 0
Báo cáo y học:

Báo cáo y học: " There has been a lack of investigation into the spatial distribution and clustering of suicide in Australia, where the population density is lower than " pot

Báo cáo khoa học

... was applied as a reference to combine the SLAs into LGAs MapInfo 9.0 was used as a platform to perform the data linkage, transfer and spatial display Population data in total, by gender and age ... Brisbane City had 163 SLAs in 20 01), and in rural and remote areas that make up the majority of Queensland territory, each LGA is also an SLA The LGA information, including name, code and area (km ... 24 -years for youth and adolescents, 25 to 44-years for young adults, 45 to 64-years for middle-aged adults, and ≥65-years for elderly) at a LGA level, were also collected from CDATA Data analysis...
  • 10
  • 356
  • 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx

Báo cáo khoa học

... Antibacterial and antifungal activities of trappin -2 22 23 24 25 26 27 28 29 30 31 K Baranger et al and pre-elafin (trappin -2) expressed in Pichia pastoris Eur J Biochem 27 1, 23 70 23 78 Latge JP (20 01) The ... Effect of NaCl and heparin on the antibacterial and antifungal activities of trappin -2 The antimicrobial and antifungal activities of trappin -2 are probably due to its cationic nature (net charge ... heparin-Sepharose affinity chromatogra- FEBS Journal 27 5 (20 08) 20 08 20 20 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 20 11 Antibacterial and antifungal activities of trappin -2 K Baranger et al A fumigatus...
  • 13
  • 610
  • 0
d. Hadn''''t it been b 41. The talks in the classroom, in the corridor and in the schoolyard do not pdf

d. Hadn''''t it been b 41. The talks in the classroom, in the corridor and in the schoolyard do not pdf

Kỹ năng nói tiếng Anh

... several apartment buildings a shower b demolish c ambush d transfer b 31 There are three kinds of solar eclipses: one is total, another is annular, and a the another is partial b the partial ... out between us a come together b gather together c get together d meet together > b 50 The ball went towards a passing boat It went of a passing boat a forwards b forward c in the direction ... popular summer resort area a Martha’s Vineyard is b is where Martha’s Vineyard c Martha’s Vineyard d is Martha’s Vineyard > d 28 "What is wood used for? " "It is used for chairs and tables a make...
  • 43
  • 491
  • 0
Báo cáo y học:

Báo cáo y học: " Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2" ppsx

Báo cáo khoa học

... mutant CLEC -2 N19 2A, 5'-TTGAGTTTTTGGCCGATGGAAAAGG-3' (sense) and 5'-TCCTTTTCCATCGGCCAAAAACTCA3' (antisense) for mutant CLEC -2 E18 7A, 5'-GTTTTTGGAAGATGGAGCCGGAAATATGAATTGTG-3' (sense) and 5'-AATTCATATTTCCGGCTCCATCTTCCAAAA3' ... 5'-AATTCATATTTCCGGCTCCATCTTCCAAAA3' (antisense) for mutant CLEC -2 K19 0A, 5'-GCAACATTG TGGAATATATTGCGGCGCGCACCCATCTGATTC-3' (sense) and 5'-GCGCCGCAATATATT CCACAATG-3' (antisense) for mutant CLEC -2 K15 0A ... "TTCAAGAGA" and an antisense shRNA sequence followed by a pol III terminator sequence The shRNA was constructed by annealing shRNA137sense_BamHI: 5'GATCCGCGAAGATGAT GTGGTGACTTTCAAGAGAAGTCACC ACATCATCTTCGTTTTTTACGCGTG3'...
  • 18
  • 294
  • 0
Chương 2: Quần thể sinh vật

Chương 2: Quần thể sinh vật

Môi trường

... quần thể, Allee a qui luật phân bố quần tụ (aggregation) b) Qui luật quần tụ (nguyên tắc Allee) Quan hệ cá thể quần thể quan hệ hỗ trợ quan hệ đấu tranh (trực tiếp hay gián tiếp) Mối quan hệ sinh ... nhân thiên tai, dịch bệnh hay hoạt động ngời (nh trờng hợp năm 1859 nhập 12 đôi thỏ châu Âu vào trại chăn nuôi Victoria, năm sau số lợng chúng tràn ngập lãnh thổ hai vùng Quinslan nam úc, đến ... sâu (Anthonomus agrandis) Texaz chịu chi phố độ ẩm tơng đối, nhiệt độ độ mây vào tháng tháng Nhìn chung, động vật, thời giannhạy cảm thờng trùng với m a sinh sản vào giai đoạn sơ sinh Ngoài ra,...
  • 18
  • 1,682
  • 16
Valle: book 2 of the heku series

Valle: book 2 of the heku series

Tài liệu khác

... edge of the bed and handed her a cracker Emily took it and looked at it for a while before taking a tiny bite “You‟re going to have to better than that.” “If it stays down, I‟ll take another,” ... away,” she said again “If you need me, just call,” he told her as he left hesitantly Chevalier stepped into the ante-chamber and told Anna to leave Emily alone, then went down to his office and ... chuckling She took another bite and then sighed, “Please go away.” He looked at her and raised an eyebrow, “What if I say no?” She glared at him and he again found the restraint not to laugh “You‟re...
  • 11
  • 372
  • 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Thạc sĩ - Cao học

... Metaphor foremotions +HAPPY-AS-UP+ metaphor Metaphor for aspects of anger ex Myspiritsrose Metaphor for anger cause of anger Metaphor for aspects of romanticlove Metaphor for aspects of sexualdesire ... regarded as metaphorical, lies in the fact that they deviate from the standard, most straightforward realization of a command by means of the imperative mood Their metaphorical nature can be made ... process (a verb, fail, and its participants, He + the exam) is not realized by means of a clause, but rather by means of another type of form, such as a noun phrase, as in the example at hand In...
  • 53
  • 1,013
  • 3
Bài 2 Chủ thể QHQT

Bài 2 Chủ thể QHQT

Tài liệu khác

... gia chủ thể QHQT quan trọng 18 Các vấn đề tranh luận • Quốc gia chủ thể thể (Unitary Actor) hoạt động QHQT mình? • Quốc gia chủ thể có lý trí (Rational Actor) sách đối ngoại? • Vai trò Quốc gia ... BÀI 2: CHỦ THỂ QHQT KHÁI NIỆM VÀ PHÂN LOẠI CHỦ THỂ QHQT QUỐC GIA 2. 1 Khái niệm Quốc gia 2. 2 Chủ quyền Quốc gia 2. 3 Lợi ích Quốc gia 2. 4 Vai trò chủ thể QHQT quốc gia 2. 1 Khái niệm Quốc gia (State) ... (Intergovernmental Organization - IGO) - TCQT tư (private) có thành viên cá nhân nhóm Trên góc độ QHQT, TCQT phi phủ (International Nongovernmental Organization - INGO) 25 TCQT liên phủ (IGO) UN NATO EU WTO...
  • 42
  • 1,919
  • 8

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25