2 3 power spectral density and autocorrelation function

Báo cáo y học: "Case report: Severe mercuric sulphate poisoning treated with 2,3-dimercaptopropane-1-sulphonate and haemodiafiltratio" ppt

Báo cáo y học: "Case report: Severe mercuric sulphate poisoning treated with 2,3-dimercaptopropane-1-sulphonate and haemodiafiltratio" ppt

Ngày tải lên : 12/08/2014, 19:22
... 6.60 57 .2 425 25 Data set 28 14 15 47 51 .3 9.14 37 .5 28 .5 15 .3 51 .2 3. 66 0.0 139 0 .31 8 0.0019 2. 33 5 72 50.0 3 62 10 .2 10.7 32 . 3 32 . 4 4.98 23 .1 10.6 32 . 3 Data minus Parameter estimate first point % ... (/h) C2a (µg/l) λ2a (/h) C3a (µg/l) λ3a (/h) Clearance (l/h) Vssb x(l) λ1 t½c (h) 2 t½c (h) 3 t½d (h) 15 .2 0.105 3. 18 0.0 121 0 .27 3 0.0016 1.74 38 1 6.60 57 .2 425 25 Data set 28 14 15 47 51 .3 9.14 ... days 16, 19, 22 , 25 , 29 , 31 , 34 and 37 He had a further episode of haematemesis on day 9; upper gastrointestinal endoscopy (oesophagogastroduodenoscopy) showed confluent gastritis and two gastric...
  • 6
  • 243
  • 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

Ngày tải lên : 16/03/2014, 16:20
... Lapthorn, A.J (20 02) Structure of a tau class glutathione 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 S-transferase from wheat active in herbicide detoxification Biochemistry 41, 7008–70 020 Labrou, ... A and B, including a-helix H¢¢ 3 (residues 188– 122 ) A large difference is centred on Met 121 In particular, the mean B-factors of Met 121 at ˚ ˚ the A and B chains are 26 .67 A2 and 49 .26 A2, and ... Phe51Ala mutant Carboxy groups 26 .8 ± 0 .3 Primary amino 14.9 ± 0.1 groups 29 .2 ± 0 .2 16 .2 ± 0 .2 31 .2 ± 0 .3 17 .3 ± 0 .3 Table Steady-state kinetic parameters of unmodified and SDTGmodified GST I for the...
  • 9
  • 556
  • 0
Climate change as environmental and economic hazard - phần 2.3

Climate change as environmental and economic hazard - phần 2.3

Ngày tải lên : 07/10/2012, 15:57
... 1900 20 05 Natural Hazards Review, 29 – 42 Pierrehumbert, R T., 20 04 Warming the world Nature, 4 32 ( 7018) 677 Pimm, S L., 1984 The complexity and stability of ecosystems Nature, 30 7(5949) 32 1 – 32 6 ... al., 20 03; Papacharissi and de Fatima Oliveira, 20 08); pandemics (Buus and Olsson, 20 06; Shih et al., 20 08; Ungar, 20 08) and climate change (McComas and Shanahan, 1999; Weingart et al., 20 00; ... homeowners Landscape and Urban Planning, 73 (2 3) 120 – 135 Pelling, M., 20 03 The Vulnerability of Cities: Natural Disasters and Social Resilience Earthscan, London Pielke, R A., Prins, G., Rayner, S and...
  • 8
  • 685
  • 0
Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx

Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx

Ngày tải lên : 11/12/2013, 14:15
... disconnect and press Enter Upon completion of the previous steps, logoff by typing exit Turn the router off 2- 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4 .2. 3 Copyright  20 03, Cisco Systems, ... legal abbreviation that can be used in IOS command to represent the interface 4-4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4 .2. 3 Copyright  20 03, Cisco Systems, Inc ... Basics v 3. 0 - Lab 4 .2. 3 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5...
  • 4
  • 544
  • 4
Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions doc

Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions doc

Ngày tải lên : 11/12/2013, 14:15
... type disconnect and press Enter Upon completion of the previous steps, logoff by typing exit Turn the router off 2- 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4 .2 Copyright  20 03, Cisco Systems, ... legal abbreviation that can be used in IOS command to represent the interface 4-4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4 .2 Copyright  20 03, Cisco Systems, Inc ... 3. 0 - Lab 4 .2 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806)...
  • 4
  • 441
  • 0
Tài liệu Lab 2.3.7 OSI Model Characteristics and Devices pptx

Tài liệu Lab 2.3.7 OSI Model Characteristics and Devices pptx

Ngày tải lên : 21/12/2013, 19:15
... Logical Grouping Devices or Components that Operate at this Layer 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 2. 3. 7 Copyright  20 03, Cisco Systems, Inc ... 2 List the seven layers of the OSI model and the encapsulation unit used to describe the data grouping at each layer...
  • 2
  • 368
  • 0
Tài liệu Lab 2.3.7 OSI Model Characteristics and Devices docx

Tài liệu Lab 2.3.7 OSI Model Characteristics and Devices docx

Ngày tải lên : 21/12/2013, 19:15
... Logical Grouping Devices or Components that Operate at this Layer 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 2. 3. 7 Copyright  20 03, Cisco Systems, Inc ... 2 List the seven layers of the OSI model and the encapsulation unit used to describe the data grouping at each layer...
  • 2
  • 530
  • 0
iec 60076-3 power transformers - insulation levels, dielectric tests and external clearances in a

iec 60076-3 power transformers - insulation levels, dielectric tests and external clearances in a

Ngày tải lên : 25/12/2013, 10:34
... impulse withstand AC withstand voltage kV r.m.s kV peak 20 36 ,- 10 40 72 - 20 60 121 7,5 - 28 75 38 95 24 50 125 145 70 170 52 60 15 72, 5 I 28 0 32 5 40 150 185 1 23 550 23 0 650 27 5 170 32 5 750 NOTE ... plus 6levộe pour le U, kV efficaces I I 20 3, 6 10 40 2y 12 - 20 - 60 28 75 38 95 50 '2 15 36 25 0 70 52 115 32 5 60 28 0 72. 5 145 140 "' , ' 650 27 5 170 32 5 750 VOTE Les lignes en pointillộs peuvent ... Information Handling Services STD-IEC b007h -3- ENGL 20 00 m 48448 93 0 727 7 72 754 m - 38 - 60076 -3 O CEI :20 00 12 Essai par tension induite en FI (FI CD, FI LD) 12. 1 Gộnộralitộs Les paragraphes 12. 2 et 12. 3...
  • 125
  • 632
  • 9
Tài liệu Activity 2.3: Identifying the Business Challenge and Vision Statement ppt

Tài liệu Activity 2.3: Identifying the Business Challenge and Vision Statement ppt

Ngày tải lên : 24/01/2014, 10:20
... below You will use this in the next exercise and future activities 12 Activity 2. 3: Identifying the Business Challenge and Vision Statement Exercise 2: Developing the Vision Statement ! Develop ... understandable, and precise Write the business challenge in the space below Duplicate your business challenge on a piece of flip-chart paper Activity 2. 3: Identifying the Business Challenge and ... meaningful, understandable, and precise Clearly identify a vision statement that will address the business challenge Duplicate your vision statement on a piece of flip-chart paper Activity 2. 3: Identifying...
  • 6
  • 363
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20
... Journal 27 7 (20 10) 133 1– 134 4 ª 20 10 The Authors Journal compilation ª 20 10 FEBS S Stasinopoulos et al 29 30 31 32 33 34 35 36 37 38 39 40 41 sequence features controlling mRNA deadenylation and decay ... Nucleotide sequence (5¢- to 3 ) Orientation SJS 133 SJS 134 SJS 137 SJS 138 SJS1 72 SJS1 73 SJS174 SJS175 SJS259 SJS260 SJS261 SJS2 62 SJS167 SJS170 ALS 030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC ... (nt 128 1– 129 8 PAI -2) Reverse (nt 1860–18 43 PAI -2) Forward (nt 1491–1508 PAI -2) Reverse (nt 1 620 –16 03 PAI -2) Forward (nt 1491–1 520 PAI -2) Reverse (nt 1 520 –1491 PAI -2) Forward (nt 1596–1 625 PAI -2) ...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... and H -3) , 1.75 2. 4 (8H, m, O-CH2-CH2, P+–CH2-CH2, H-1 and H -2) p.p.m., 31 PNMR d 25 .65 p.p.m ESMS found (M+) 5 63 .24 69 calculated for C35H36O3N2P (M+) 5 63 .24 58 H (30 0 MHz) and 31 P ( 121 MHz) NMR spectra ... ( 12 mg, 0.014 mmol, 14%) 1H NMR d 7.6–7.9 (m (16H, P+–ArH and H-11), 7.46 (1H, s, H-6), 6.49 (1H, s, H-9), 4.1–4 .2 (2H, m, Ar-O-CH2), 3. 71 (3H, s, O-CH3), 3. 4– 4.0 (5H, m, P+–CH2, H-11a and H -3) , ... Genet 106, 27 36 Smeitink, J., van den Heuvel, L & DiMauro, S (20 01) The genetics and pathology of oxidative phosphorylation Nature Rev Genet 2, 3 42 3 52 James, A.M & Murphy, M.P (20 02) How mitochondrial...
  • 10
  • 638
  • 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Ngày tải lên : 21/02/2014, 01:21
... deoxyribonucleic acid by 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 high-performance liquid chromatography Int J Syst Bacteriol 39 , 159–167 Moss, C.W & Guerrant, G.O (19 83) Separation of bacterial ... 1: 2: 3: 4: 5: 6: 7: 8: 850 830 800 610 400 160 97 22 420 0 420 0 790 460 90 0 .20 0 .20 1.0 1 .3 4.4 18 24 22 100 98 94 72 46 19 11 Cell extract Streptomycin sulfate Ammonium sulfate Acetone DE 52 ... and gene analysis of catechol 2, 3- dioxygenase from the aniline-assimilating bacterium Pseudomonas species AW -2 Biosci Biotechnol Biochem 62, 747–7 52 Ó FEBS 20 02 4-Amino -3- hydroxybenzoate 2, 3- dioxygenase...
  • 7
  • 490
  • 0
Báo cáo khoa học: Typical 2-Cys peroxiredoxins – structures, mechanisms and functions ppt

Báo cáo khoa học: Typical 2-Cys peroxiredoxins – structures, mechanisms and functions ppt

Ngày tải lên : 07/03/2014, 01:20
... catalysis as the result of the FEBS Journal 27 6 (20 09) 24 69 24 77 ª 20 09 The Authors Journal compilation ª 20 09 FEBS A Hall et al 27 28 29 30 31 32 33 34 35 36 37 38 39 40 oxidation of the catalytic site ... structural and functional differences between Prx1 and Prx2 J Biol Chem 28 2, 22 011 22 022 Rabilloud T, Heller M, Gasnier F, Luche S, Rey C, Aebersold R, Benahmed M, Louisot P & Lunardi J (20 02) Proteomics ... and oligomeric state J Mol Biol 3 72, 1 022 –1 033 18 Matsumura T, Okamoto K, Iwahara S, Hori H, Takahashi Y, Nishino T & Abe Y (20 08) Dimer–oligomer interconversion of wild-type and mutant rat 2- Cys...
  • 9
  • 318
  • 0
UNIT 3. OPTIONS, CHOICES, TOOLS AND APPLICATIONS LESSON 2. TOOLS AND APPLICATIONSNOTE doc

UNIT 3. OPTIONS, CHOICES, TOOLS AND APPLICATIONS LESSON 2. TOOLS AND APPLICATIONSNOTE doc

Ngày tải lên : 08/03/2014, 20:20
... Sinclair, J .What a wiki thing to Sydney Morning Herald July 22 20 03 http://www.smh.com.au/articles /20 03/ 07 /21 /1058 639 7 120 33 .html Common Craft 20 03 Wikis described in plain English, http://www.commoncraft.com/archives/000644.html ... for Progressive Communications Understanding Civil Society Portals http://www.apc.org/apps/img_upload/b56060111868b 1 23 a8b 538 35707e53fb/983a73bf83d6b54159db2dde4e1bcd9d.zip If you want to know ... written 12. 20 e-mail queued 12. 30 e-mail sent 12. 31 e-mail received on recipient’s server 1.15 e-mail collected from server by recipient 1 .30 e-mail read by recipient 1 .35 Recipient writes and send...
  • 71
  • 326
  • 0
electric power generation, transmission, and distribution ( (2)

electric power generation, transmission, and distribution ( (2)

Ngày tải lên : 21/03/2014, 12:08
... April 29 –May 1, 19 92 Solar magnetic disturbances=geomagnetically-induced current and protective relaying, Electric Power Research Institute Report TR-1 026 21, Project 32 1 -04, August 19 93 Warrington, ... period of de-energization 1 .3. 3 Primary-Secondary Phase-Shift For transformers with standard delta-wye connections, the currents on the delta and wye sides will have a 30 8 phase shift relative to ... maintenance and cost advantages found with power fuses Protection and control devices, circuit breakers, and station batteries are required The overcurrent relays are a small part of the total cost and...
  • 12
  • 600
  • 1
electric power generation, transmission, and distribution ( (3)

electric power generation, transmission, and distribution ( (3)

Ngày tải lên : 21/03/2014, 12:08
... Function 21 : Distance relay Backup for system and generator zone phase faults Function 32 : Reverse power relay Anti-motoring function, sequential tripping and inadvertent energization functions ... sec sec Xd = 21 .6 −15 20 25 FIGURE 2. 8 X’d /2 = 2. 45 20 −10 10 REAL PART OF Z1 (OHMS) Loss-of-field positive sequence impedance trajectory ß 20 06 by Taylor & Francis Group, LLC 20 1000 MAXIMUM ... prime-mover), (3) the sequential tripping function is enabled, then a trip signal will be sent to the generator and field breakers ß 20 06 by Taylor & Francis Group, LLC 52 B 52 A 52 C 50N 52a T1 Current...
  • 20
  • 468
  • 1
power system stability and control chuong (2)

power system stability and control chuong (2)

Ngày tải lên : 21/03/2014, 12:11
... bibliographical references and index ISBN- 13: 978-0-84 93- 929 2-4 (alk paper) ISBN-10: 0-84 93- 929 2-6 (alk paper) Electric power production Electric power distribution Electric power transmission I Grigsby, ... Melhorn 30 Harmonics in Power Systems S.M Halpin 31 Voltage Sags Math H.J Bollen 32 Voltage Fluctuations and Lamp Flicker in Power Systems S.M Halpin ß 20 06 by Taylor & Francis Group, LLC 33 Power ... TK1001.E25 20 07 621 .31 dc 22 Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com ß 20 06 by Taylor & Francis Group, LLC 20 07006454...
  • 14
  • 498
  • 5
power system stability and control chuong (3)

power system stability and control chuong (3)

Ngày tải lên : 21/03/2014, 12:11
... 2= 96 3= 96 4=96 5=96 6=96 7=96 8=96 9=96 10=96 11=96 12= 96 14.9 16 .2 17.6 19.8 18.4 13. 5 12. 5 11.6 12. 4 17.1 15 .3 15.1 20 .3 22 .4 22 .3 25 .2 23. 1 18 .2 16.5 16.0 17 .2 23. 3 20 .0 20 .1 25 6 29 0 28 1 32 2 ... 28 1 32 2 29 7 20 3 169 156 1 82 32 0 23 5 24 7 1=97 2= 97 3= 97 4=97 5=97 6=97 7=97 8=97 9=97 10=97 11=97 12= 97 15.8 14.7 17.4 15.9 15 .2 11.9 13. 3 11.7 13. 6 15.0 14 .3 13. 6 21 .2 19.0 22 .8 20 .4 19.8 16 .3 18.5 ... 16.9 19.0 21 .1 19.7 19.5 26 9 20 7 29 1 24 2 23 6 167 21 2 176 21 1 26 5 23 9 23 5 speeds at 40 and 60 m were used to estimate the wind speed at 65 m (the nominal tower height of the V47-660) and to calculate...
  • 10
  • 611
  • 3