2 14 thẻ kho thạch cao
Thế giới quảng cáo phần 2
Ngày tải lên :
15/08/2013, 15:53
... bóng Nike Đồ chơi xếp hình Lego Trụ sở Discovery Channel (kênh truyền hình khám phá VTV1 & VTV2 ) Nescafe Pepsi Khỏe lực sĩ Máy ảnh cannon (cannon = súng thần công) ...
- 13
- 325
- 0
Tài liệu Thế giới quảng cáo - Phần 2 pdf
Ngày tải lên :
24/01/2014, 01:20
... bóng Nike Đồ chơi xếp hình Lego Trụ sở Discovery Channel (kênh truyền hình khám phá VTV1 & VTV2 ) Nescafe Pepsi Khỏe lực sĩ Máy ảnh cannon (cannon = súng thần công) ...
- 13
- 418
- 0
Tài liệu Mở rộng InfoSphere Data Architect của IBM để đáp ứng các yêu cầu mô hình hóa và tích hợp dữ liệu cụ thể của bạn, Phần 2: Xây dựng các báo cáo tùy chỉnh và các quy tắc xác nhận hợp lệ với IDA pdf
Ngày tải lên :
22/02/2014, 15:20
... Model, kết xác nhận hợp lệ dựa vào ràng buộc phép xuất khung nhìn Problems (Các vấn đề), thể 22 Hình 22 Các kết mô hình phân tích xuất khung nhìn Problems Thêm ràng buộc Điểm mở rộng org.eclipse.emf.validation.constraintProviders ... tính riêng tư) (đặt tên tệp ColumnWithPrivacy chọn thư mục hộp thoại báo cáo dán liệu), Hình 14 Hình 14 Báo cáo Cột có tính riêng tư tạo từ Column Report Nhấn đúp chuột vào Column Report with ... SAMPLE, bạn thấy trường Masking Method giá trị HASHING với cột BONUS (Tiền thưởng), thể Hình 20 Hình 20 Báo cáo Cột có tính riêng tư với cột phương thức mặt nạ Về đầu trang Thêm quy tắc xác nhận...
- 29
- 593
- 1
Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx
Ngày tải lên :
05/03/2014, 23:20
... 117–131 21 Ellouz F, Adam A, Ciorbaru R & Lederer E (1974) Minimal structural requirements for adjuvant activity of UCP2 modulates MDP-induced mitochondrial inefficiency 22 23 24 25 26 27 28 29 30 ... 100 101 PI 1 02 103 A 104 MB (100 lgÆmL)1) 100 ± 1 12 ± 14 .2 107 ± 10.8 95.68 ± 4.6 LPS (1 lgÆmL)1) 100 ± 1.5 1 02 ± 12. 3 98 ± 7.6 98 .27 ± 8 .2 100 101 1 02 103 Annex-FITC 104 100 101 1 02 103 Annex-FITC ... UCP2 FEBS Journal 27 8 (20 11) 3054–3064 ª 20 11 The Authors Journal compilation ª 20 11 FEBS T G El-Khoury et al UCP2 modulates MDP-induced mitochondrial inefficiency 10 ** ** 120 80 40 US * UCP2...
- 11
- 430
- 0
Báo cáo khoa học: Glucagon-like peptide-2 stimulates the proliferation of cultured rat astrocytes pptx
Ngày tải lên :
17/03/2014, 03:20
... 12. 6 ± 2. 4 9.7 ± 1.7 7.0 ± 1.1c 3 .2 ± 0.4 2. 7 ± 0.6 2. 0 ± 0.1c 18 Control GLP -2 Fetal bovine serum 79 .2 ± 5.3 70.1 ± 1.9c 72. 9 ± 3.7 16.0 ± 4.3 24 .7 ± 1.6c 23 .9 ± 3.4c 4.9 ± 1.0 5 .2 ± 0.3 3 .2 ± ... ± 2. 0d 53.9 ± 1.3d 17.4 ± 2. 1 33.5 ± 2. 3d 33 .2 ± 0.7d 7.3 ± 1.0 11.0 ± 0.3d 12. 9 ± 0.4d 30 Control GLP -2 Fetal bovine serum 83.9 ± 1.3 73.1 ± 1.2d 86.6 ± 2. 0 8.6 ± 1 .2 24.0 ± 1.0d 6.5 ± 0.2c ... 62. 0 55.5 17.4 20 .7 23 .5 24 .8 28 .4 33.5 a e ± ± ± ± ± ± 0.5 3.2c 3.0d 1.4e 3.4e 2. 0e Astrocytes were incubated with GLP -2 for 24 h P < 0.001 vs the zero dose b ± ± ± ± ± ± % G2-Mb 0.5 0.8c 2. 0d...
- 9
- 448
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
Ngày tải lên :
31/03/2014, 08:20
... Y51AMY2 and Y82TAA are in orange Other binding residues (W9AMY2, H92AMY2, T94AMY2, A95AMY2, Y130AMY2, A145AMY2, F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y211AMY2, H288AMY2, Q294AMY2, M296AMY2 and ... GH77 4763 46 62 6883 7489 7186 6883 50 72 90113 69 92 96119 111135 20 221 7 4866 7895 7895 8 128 30 25 528 5 84109 84101 6896 19 521 4 477494 20 021 7 19 621 3 5775 5573 6381 23 625 3 4160 25 728 6 11 8144 4867 711736 ... (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H 122 TAA; M52AMY2 (M53AMY1) and W83TAA are at subsite )2; ...
- 14
- 557
- 0
báo cáo hóa học:" Expression of Bone Morphogenetic Protein-2 in the Chondrogenic and Ossifying Sites of Calcific Tendinopathy and Traumatic Tendon Injury Rat Models" doc
Ngày tải lên :
20/06/2014, 04:20
... 12 (p = 0 .22 5) There was significant difference in mRNA level of BMP -2 between week and week with week 12 (overall: p = 0. 021 ; post-hoc comparison: week vs week 12: p = 0.016; week vs week 12: ... Chem 20 08, 28 3(43) :29 513 -29 521 Hashimoto Y, Yoshida G, Toyoda H, Takaoka K: Generation of tendon-to-bone interface "enthesis" with use of recombinant BMP -2 in a rabbit model J Orthop Res 20 07, 25 (11) :141 5-1 424 ... collagenase-induced tendon degeneration J Histochem Cytochem 20 09, 57 (2) :91-100 Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins Growth Factors 20 04, 22 (4) :23 3 -24 1 Hoshino M, Egi T, Terai H, Namikawa T, Kato...
- 6
- 291
- 0
Toán 2- Giờ phút- Thế- TH Nam Cao
Ngày tải lên :
17/07/2014, 10:01
... Kiểm tra cũ Bảng tay: ngày = 24 Hỏi: 24 ngày đợc tính nh nào? Trả lời: 24 ngày đợc tính từ 12 đêm hôm trớc đến 12 đêm hôm sau Lên bảng: Quay kim đồng hồ chỉ: giờ, giờ, ... Bài 3: Tính (theo mẫu): a) + = b) - = Lên bảng: + + =2 = giờ giờ - = giờ - = Vở: + +=6 = 10 12 - = giờ + +=7 = 15 16 16 - 10 = giờ = 60 phút Bài 2: Mỗi tranh vẽ ứng với đồng hồ nào? Mai ngủ dậy lúc ... Thực hành Bài 1: Đồng hồ ? A A B B A D C B C C D D = 60 phút giờ 15 phút Thực hành 30 phút rỡi Bài 2: Mỗi tranh vẽ ứng với đồng hồ nào? Mai ngủ dậy lúc Mai đến trờng lúc 15 phút Mai ăn sáng lúc 15...
- 8
- 262
- 0
Báo cáo khoa học: "Immunohistochemical Localization of Bcl-2 in the Spinal Cords of Rats with Experimental Autoimmune Encephalomyelitis" docx
Ngày tải lên :
07/08/2014, 15:20
... (G3, day 12 PI), lanes and 8; EAE (R0, day 21 PI) Immunohistochemical Localization of Bcl -2 in the Spinal Cords of Rats with Experimental Autoimmune Encephalomyelitis 28 1 Table Bcl -2 immunoreactivity ... Neurobiol 1998, 24 , 20 2 -20 8 Zirbes, T.K., Lorenzen, J , Baldus, S.E., Moenig, S.P , Wolters, U., Ottlik, A., Thiele, J., Holscher, A.H., Dienes, H.P Apoptosis and expression of Bcl -2 are inverse ... cl -2 in EAE Bcl -2 was constitutively expressed in the normal rat spinal cord (Fig 1, lane 1), and expression increased in response to immunization with CFA (Fig 1, lane 2) The degree of Bcl-2...
- 5
- 295
- 0
Báo cáo khoa học: "Immunohistochemical study of caveolin-1 and -2 in the rat retina" pps
Ngày tải lên :
07/08/2014, 18:21
... otomakO ,Z gnaT ,EP rerehcS ,SK gnoS 41 422 - 122 , 62 ,6991 seR teV J naeroK aniter kcud eht no dica ciniak fo stceffE M miK ,T nihS 31 02- 11 ,561 ,50 02 lonummiorueN J sitileymolahpecne enummiotua ... otomihsiN ,M nuhC ,T otomakO ,EP rerehcS 11 643 92 -733 92 ,27 2 ,7991 mehC loiB J oviv ni xelpmoc ciremogilo -oreteh elbats a mrof dna ezilacol-oc dna sniloevaC 2- niloevac fo noisserpxe cificeps-eussit ... ,561 ,40 02 lohtaP J mA stfar dipil lanoruen ni niloevac dna nisyhpotpanys fo noitubirtsid eht sretla noitacilper noirP C otoS ,K llerdnuaM ,C zteH ,M orienraC-sikalessuR 022 -591 ,9 ,40 02 tteL loiB...
- 4
- 364
- 0
Báo cáo khoa học: "Soil CO in a beech forest: 2 efflux the contribution of root respiration Daniel" pptx
Ngày tải lên :
08/08/2014, 14:21
... forest ecosystems, Can J Bot 68 (1990) 22 01 -22 08 [2] Bauhus J., Bartsch N., Fine-root growth in beech (Fagus sylvatica) forest gaps, Can J For Res 26 (1996) 21 53 -21 59 [3] Bouma T., Nielsen K.L., Eissenstat ... Res 23 (1993) 14 02- 140 7 [5] Bréda N., Granier A., Barataud F., Moyne C., Soil water in an oak stand Part I Soil moisture, water potentials and water uptake by roots, Plant Soil 1 72 (1995) 17 -27 ... underestimated ( 52 % instead of 60 %) Fine root production in our stand (0.13 kg m DM -2 is lower than those reported for older beech forests (0.44 in a 120 -year-old stand [26 ] and 0.39 in a 145 -year-old...
- 7
- 368
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
Ngày tải lên :
09/08/2014, 01:22
... Karlsson S: Transforming growth factor beta null mutation in mice causes excessive 18 19 20 21 22 23 24 25 26 27 inflammatory response and early death Proc Natl Acad Sci USA 1993, 90:770-774 Abdel-Wahab ... phospho-MAPK (ERK1 /2) (Thr2 02/ Tyr204), p44/ 42 MAPkinase (ERK1 /2) , and p27 Kip1 were from Cell Signaling Technology (Beverly, MA, USA) Polyclonal rabbit antibodies against rat p15 INK4b, p21 WAF1/Cip1 ... Cancer Cell 20 03, 4 :22 3 -23 8 56 Gomez-Curet I, Perkins RS, Bennett R, Feidler KL, Dunn SP, Krueger LJ: c-Myc inhibition negatively impacts lymphoma growth J Pediatr Surg 20 06, 41 :20 7 -21 1 57 Huang...
- 12
- 535
- 0
Báo cáo y học: "Action of fibroblast growth factor-2 on the intervertebral disc" docx
Ngày tải lên :
09/08/2014, 10:23
... repair Spine 20 02, 27 :1756-1764 Thompson JP, Pearce RH, Schechter MT, Adams ME, Tsang IK, Bishop PB: Preliminary evaluation of a scheme for grading the 22 23 24 25 26 27 28 29 30 31 32 33 34 35 ... chondrocytes J Biol Chem 20 07, 28 2: 3140 9-31 421 Peng B, Hao J, Hou S, Wu W, Jiang D, Fu X, Yang Y: Possible pathogenesis of painful intervertebral disc degeneration Spine 20 06, 31:560-566 Doita ... http://arthritis-research.com/content/10 /2/ R48 10 11 12 13 14 15 16 17 18 19 20 21 Buckwalter JA: Aging and degeneration of the human intervertebral disc Spine 1995, 20 :1307-1 314 Freemont TJ, LeMaitre C,...
- 12
- 584
- 0
Báo cáo nghiên cứu khoa học " Trung Quốc trong khu vực: Vị thế và thách thức " ppt
Ngày tải lên :
10/08/2014, 16:22
... Quốc năm 19 82 đạt 180 triệu USD, năm 20 07 tăng 66 lần, đạt 12 tỷ USD Tính đến cuối năm 20 07, Trung Quốc thu nhận từ châu 120 nghìn hạng mục đầu tư, với tổng giá trị hợp đồng 29 7 ,2 tỷ USD, kim ... châu đạt 1,16 tỷ USD; năm 20 07 đạt 8,65 tỷ USD, tăng lần năm Đặc biệt, năm 20 07, đầu tư thực tế Trung Quốc sang nước châu đạt số 2, 44 tỷ USD, tăng 25 1,5% so với năm 20 06 Pakistan, Hàn Quốc, Xinhgapo, ... lên 757,9 tỷ USD vào năm 20 07, chiếm 1/3 tổng kim ngạch mậu dịch Trung Quốc Riêng năm 20 08, tổng kim ngạch mậu dịch Trung Quốc – châu đạt 136 tỷ USD, tăng 149 % so với năm 20 07 Trong xuất đạt 663...
- 12
- 295
- 0
Báo cáo y học: "Molecular characterization of partial-open reading frames 1a and 2 of the human astroviruses in South Korea" ppsx
Ngày tải lên :
12/08/2014, 01:21
... 1990:115-173 Prasanna et al Virology Journal 20 10, 7 :22 0 http://www.virologyj.com/content/7/1 /22 0 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Slatkin M: Gene flow and population ... Entomology, 19 -23 August 1984; Hamburg FRG Agric Ecosyst Environ 1986, 17:15 -20 Prasanna et al Virology Journal 20 10, 7 :22 0 http://www.virologyj.com/content/7/1 /22 0 Page 12 of 12 53 Sanchez-Campos ... sub-population (S-AL in Fig 2) With K = 5, the eAf-CAS viruses were split from the Af-Med sub- Prasanna et al Virology Journal 20 10, 7 :22 0 http://www.virologyj.com/content/7/1 /22 0 Page of 12 Figure Sequential...
- 12
- 413
- 0
Báo cáo y học: "Molecular characterization of partial-open reading frames 1a and 2 of the human astroviruses in South Korea" doc
Ngày tải lên :
12/08/2014, 01:21
... Sequence (5’!3’) Mon340 11 82- 120 3 CGTCATTATTTGTTGTCATACT Size References (bp) 28 9 [26 ] 449 [24 ] Mon348 145 0 -147 0 ACATGTGCTGCTGTTACTATG Mon269 4 526 -4545 CAACTCAGGAAACAGGGTGT Mon270 4955-4974 TCAGATGCATTGTCATTGGT ... Novel astroviruses in insectivorous bats J Virol 20 08, 82: 9107-9 114 Koci MD, Schultz-Cherry S: Avian astroviruses Avian Pathol 20 02, 31 :21 3 -22 7 Toffan A, Jonassen CM, De Battisti C, Schiavon ... whereas SE05 120 03, SE05 120 16, and SE04100 92 belonged to the HAstV-1 Dresden isolate (Fig 2) SE0501018, SE0501089, and SE040 622 4 grouped in the HAstV-8 reference, and SE0406038 and SE040 621 3 grouped...
- 5
- 414
- 0
Báo cáo y học: "Comprehensive characterization of the cis-regulatory code responsible for the spatio-temporal expression of olSix3.2 in the developing medaka forebrain" potx
Ngày tải lên :
14/08/2014, 07:22
... Genome Biology 20 07, 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Volume 8, Issue 7, Article R137 Conte and Bovolenta 129 :28 35 -28 49 Zuber ME, Perron M, Philpott A, Bang A, ... 16 -21 ANP OV + + (c) A B C D + E F GH + I L Stage 16 -21 ANP OV Stage 22 -23 OC LP + (d) + A B C D - E F GH + + I L Stage 16 -21 ANP OV Stage 22 -23 OC LP Stage 24 - 32 Brain Retina + + Stage 32- 40 ... Stage 22 -23 OC LP Stage 24 - 32 Brain Retina Stage 32- 40 Brain Retina Stage 22 -23 OC LP Stage 24 - 32 Brain Retina Stage 32- 40 Brain Retina Stage 24 - 32 Brain Retina Stage 32- 40 Brain Retina + (b)...
- 17
- 252
- 0
nghiên cứu sử dụng carrageenan và phụ liệu để thay thế thạch cao trong sản xuất đậu phụ
Ngày tải lên :
31/08/2014, 17:08
... 530 145 10 0 0 0 500 155 11 0 0 0 530 140 - 42 - Từ kết thí nghiệm ta xây dựng mô hình toán học sau: Y1 =476.875–36.875X1+36.875X2–58. 125 X3+0. 625 X1X2+18. 125 X1X3–13. 125 X2X3 Y2 = 149 .375+15. 625 X1– ... nghiệm ghi bảng (3 .2) - 41 - Bảng3 .2: Kết ma trận thí nghiệm STT X1(oC) X2(g) X3(g) Y1(g) Y2(g/cm2) 80 5.5 3 .2 550 125 90 5.5 3 .2 420 160 80 7.1 3 .2 630 115 90 7.1 3 .2 540 120 80 5.5 3.8 405 ... I [2] : Tổ chức thí nghiệm TYT2k; Với mức yếu tố; k yếu tố ảnh hưởng, k = Chọn mô tả toán học: Y = b0 +b1X1 +b2X2 + b3X3 + b12X1X2 +b23X2X3 +b13X1X3 +b 123 X1X2X3 Trong đó: b0: Hệ số tự b1,b2, b3:...
- 72
- 591
- 1