16—tubular t y and k connection fillet weld footprint radius see 2 23 3
Alloreactive t cells and cytokines in murine graft versus host disease 2
... CGACAGATACGATCGATCAA 3 Reverse 5’- AAGCATATCCTATCGATGAT 3 Forward 5’- TAGCTTCTGATCGATGCATG 3 Reverse 5’- TCTCATGCTAATCGATCGAT 3 Forward 5’- TACTGCTACTGATCGACTGC 3 Reverse 5’- ATCCATCTGGCTAGGTCAGG 3 ... GCCGATCGATCGATCGTACC 3 Forward 5’- TTACCTGATCGGCTACACTG 3 Reverse 5’- GGTCTACATCGATCGCTACT 3 Forward 5’- ATAGACTCTCCGATATAGCT 3 Reverse 5’- TAGCTATCGATCGATCGTAA 3 Forward 5’- AACCTTTAGTACCCATGCCA 3 ... CTTGAGAGTGGCTATGACTTCTGTCT 3 5’ AGGACCCCACTGCGCCCAGA 3 5’ GCTGGAGAGCTACAAGAGGATCA 3 Reverse primer: 5’ TCTCTCTTGAGCTTGGTGACAAAA 3 5’ CTACAGCTTCTTTGGGACACCTGCTGCT 3 Forward primer: 5’ AGTGATAAGGAATGCACGATGCT...
- 24
- 258
- 0
Báo cáo y học: "Comparative study of serum Na+ and K+ levels in senile cataract patients and normal individuals"
... Clinical Nutrition 1996; 63: 985990 Claytone RM, Culthbert J, et al Some risk factor associated with cataract in Scotland A pilot study Trans Ophthalmology Society, 19 82; 1 02: 33 1 -36 Borekhuyse RM ... Conflict of interest The authors have declared that no conflict of interest exists Int J Med Sci 20 04 1 (3) : 165-169 168 References 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ... West SK, Valmadrid CT Epidemiology of risk factors for age-related cataract Survey of Ophthalmology 1995; 39 : 32 3 - 32 7 Van Heyningaen R The Lens: Metabolism and cataract In: Davson H, ed The Eye...
- 5
- 611
- 1
Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps
... immunoglobulin G; H1 -T2 3 histocompatibility t2 3 region; H2-Q1 histocompatibility 2- Q region; Ifnar2 interferon-a receptor 2; Isg15 interferon-induced protein, 15 kDa; Krt-17 keratin-17; Mt1 metallothionein ... cytokine profile, implying that IFN-c may be a key cytokine in asthma . 23 IFN-c provides the stimulatory signal for interleukin (IL)- 12, 23 ,24 which is a strong inducer of the Th1 response IL- 12 ... delivery system: biocompatibility, body distribution and ability to complex and protect DNA Int J Pharm 1999;178 : 23 1– 43 12 Roy K, Mao HQ, Huang SK, Leong KW Oral gene delivery with chitosan—DNA...
- 11
- 486
- 0
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... by Student’s t- test), and between the RA patient group and the SLE patient group (P > 0.5, by Student’s t- test) Available online http://arthritis-research.com/content/5 /2/ R91 Flow cytometry ... (CD57+) T cells in patients with rheumatoid arthritis Arthritis Rheum 1997, 40 : 23 7 -24 8 Masuko-Hongo K, Sekine T, Ueda S, Kobata T, Yamamoto K, Nishioka K, Kato T: Long-term persistent accumulation ... patients with rheumatoid arthritis J Rheumatol 1996, 23 : 13 32 - 133 7 Acknowledgment Correspondence This work was supported by National Institutes of Health grants R01 AI46719 and R01 AI 520 05 to...
- 6
- 323
- 0
Báo cáo y học: "Neural immune pathways and their connection to inflammatory diseases" ppsx
... generally accepted that lower than normal cortisol responses to stimulation are characteristic of RA [169,197 ,20 1 ,21 6 ,22 1, 22 3 ,22 5 22 7] Most recently Straub and colleagues have shown that the most ... Immunol 20 01, 21 : 32 3 -33 7 65 Witzke O, Winterhagen T, Saller B, Roggenbuck U, Lehr I, Philipp T, Mann K, Reinhardt W: Transient stimulatory effects on pituitary–thyroid axis in patients treated with ... survival after trauma and contribute to neural repair [ 122 ] Cytokines Cytokines are important factors connecting and modulating the immune and neuroendrocrine systems Cytokines and their receptors...
- 15
- 481
- 0
Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps
... specifically by isolating the T lymphocyte fraction that harboured regulatory activity Sakaguchi and colleagues managed to first identify the CD5 molecule as a marker for TR cells by demonstrating that ... self-tolerance maintained by CD25+CD4+ regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen J Exp Med 20 00, 1 92: 30 3 -31 0 Read S, Malmstrom V, Powrie F: Cytotoxic T ... Takahashi T, Sakaguchi N, Kuniyasu Y, Shimizu J, Otsuka F, Sakaguchi S: Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus...
- 7
- 576
- 0
Báo cáo y học: "Natural killer T cells and rheumatoid arthritis: friend or foe" ppt
... attracted to synovial tissue and the reason(s) why they get activated locally in the K/ BXN serum transfer model to induce TGF-β1 have yet to be elucidated Taken together, the data illustrate the ... alpha-Galactosylceramide (KRN7000) in Patients with Solid Tumors Clin Cancer Res 20 02, 8 :37 02- 37 09 Miyamoto K, Miyake S, Yamamura T: A synthetic glycolipid prevents autoimmune encephalomyelitis by inducing TH2 bias ... Balk SP et al: Extreme Th1 bias of invariant Valpha24JalphaQ T cells in type diabetes Nature 1998, 39 1:177-181 Lee PT, Putnam A, Benlagha K, Teyton L, Gottlieb PA, Bendelac A: Testing the NKT...
- 2
- 225
- 0
Báo cáo y học: "Early rheumatoid arthritis is characterized by a distinct and transient synovial fluid cytokine profile of T cell and stromal cell origin" pptx
... presented herein suggest that the pathology of RA within the first few months after symptom onset is distinct from that of other early inflammatory arthritides and of established RA The nature of the ... Analysis In order to identify cytokines that distinguish patients with early RA from other patients with early synovitis and from patients with established RA, we performed univariate and multivariate ... cytokine profile that was seen in patients with early RA was transient It was not seen in established RA (Figs and 2) or after the first few months of symptoms in patients with early disease that...
- 12
- 460
- 0
Báo cáo y học: " T cells and post menopausal osteoporosis in murine models" doc
... women treated with autologous BM transplants develop thymic hypertrophy and a resurgence of thymic T cell output that contributes to the restoration of a wide T cell repertoire [29 ], although the ... 1996, 27 3: 122 2- 122 5 Miyaura C, Onoe Y, Inada M, Maki K, Ikuta K, Ito M, Suda T: Increased B-lymphopoiesis by interleukin induces bone loss in mice with intact ovarian function: similarity to estrogen ... Therapy 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Vol No Pacifici menopausal) osteoporosis: quantitative assessment of rates of formation, resorption, bone loss at tissue and cellular...
- 4
- 332
- 0
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
... function by DNA-enzymes FEBS Lett 1998, 436 : 23 3 - 23 8 Bai J, Rossi J, Akkina R: Multivalent anti-CCR5 ribozymes for stem cell-based HIV type gene therapy AIDS Res Hum Retroviruses 20 01, 17 :38 5 -39 9 ... differentiated thymocytes HIV-1 challenge of in vivo differentiated thymocytes: Vector transduced CD34+ cells were injected into SCID-hu thymic grafts and allowed to differentiate Thymocytes were harvested ... grafts for reconstitution Eight to ten weeks post reconstitution, thus allowing for T cell differentiation, the animals were sacrificed and thymocytes were isolated from the grafts The differentiated...
- 11
- 264
- 0
Báo cáo y học: "Improving therapeutic HPV peptide-based vaccine potency by enhancing CD4+ T help and dendritic cell activation" docx
... followed by flow cytometry analysis Splenocytes without peptide stimulation were used as negative control (A) Representative data of intracellular cytokine staining followed by flow cytometry analysis ... the maturation of DCs and promote the production of inflammatory Th1 cytokines such as IL- 12, while suppressing Th2 cytokines, such as IL-10 in vitro [ 23 ,24 ] Thus, we speculate that intratumoral ... CA09 825 2, the RO1 CA114 425 -01 and the P20 CA144801 (T. -C Wu) Author details Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, Maryland, USA 2Department of Obstetrics and Gynecology,...
- 10
- 341
- 0
Báo cáo y học: "Daily rhythm of circulating fat soluble vitamin concentration (A, D, E and K) in the horse" pdf
... 95% http://www.jcircadianrhythms.com/content /2/ 1 /3 day); vitamin K, at 17:00 (1st day) and at 18:08 (2nd day) It seems reasonable to hypothesise that the presence of rhythmic diurnal variations ... in the choosing of the time of day at which vitamin administration reveals its greatest effect Authors' contributions GP-Designed the study and evaluated the data statistically AA-Carried out the ... during the days of monitoring All the vitamins studied showed diurnal acrophases, as follows: vitamin A, at 15 :20 both for the 1st and the 2nd day; vitamin D2, at 14:16 (1st day) and at 15: 12 (2nd...
- 4
- 294
- 0
Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx
... ctg aac tgg ctg taa ctt ctg c -3 6MIEpex2R 5’-tct aag ctt cag caa tcc aat aat tga tg -3 6MIEpex3R 5’-cat aag ctt gca tac gtt cct cat tgg at -3 6MIEpex4R 5’-cat aag ctt cca aag ttt tga att ctt ... tac ctc ctg ttt ttg agt aag ata tga c -3 6MIEpF-165 5’-agt cgg tac cag cta att tcc att cca tat ttg tc -3 6MIEpF-1 02 5’-agt cgg tac cta cag cga ttg gct cct tca tcc tc -3 6MIEpR 5’-agt cct cga ... 5’-agt cgg tac cta ctg tgg ttg ggg tct ttc cta c -3 6MIEpF- 531 5’-acc ggt acc tac cca ggc taa cga gaa cc -3 6MIEpF -38 1 5’-agt cgg tac cac att cct gtt tca tga tgt gta gc -3 6MIEpF -21 4 5’-agt cgg tac...
- 9
- 227
- 0
Báo cáo y học: "Analysis of the 5''''UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages" potx
... ACT CCA CCA TRG ATC ACT C 9.2a-flap Negative 34 4 32 3 AAT AAA TCA TAA CAT GWT GCA CGS TCT ACG AGA C up Positive 11 28 CCC TGA TGG GGG CGA CAC TCC 34 7 down Negative 34 5 32 5 TGC TCA TGG TGC ACG GTC ... Negative 34 4 32 3 CAT GWT GCA CGS TCT ACG AGA C 10.1a Positive 48 71 CTG TGA GGA ACT WCT GTC TTC ACG CRG 10 .2 Negative 31 0 29 3 CAC TCG CAA GCA CCC TAT CAG 9.1a-flap Positive 24 42 AAT AAA TCA TAA ... (Figure 3) The sequences for 31 4 T1 and 31 4 T2 were the same, showing that consecutive transfers of HCV into the same cell type not affect the sequence The 31 4 T1 and T2 sequences were almost identical...
- 11
- 276
- 0
Báo cáo y học: "K channel openers restore verapamil-inhibited lung fluid resolution and transepithelial ion transport" potx
... 1Department of Biochemistry, University of Texas Health Science Center at Tyler, Tyler, TX 75708, USA, 2Texas Lung Injury Institute, University of Texas Health Science Center at Tyler, Tyler, TX 75708, ... clearance in the injured lung J Appl Physiol 20 02, 93( 6) :22 07 -22 13 29 Sakuma T, Takahashi K, Ohya N, Nakada T, Matthay MA: Effects of ATPsensitive potassium channel opener on potassium transport and alveolar ... basolateral K+ channels tightly regulate Na+ /K+ -ATPase activity, by coordinately acting as the K+ recycling machinery to maintain the negative resting membrane potential Resultant depolarization...
- 17
- 228
- 0
Báo cáo y học: "New role for Agrin in T cells and its potential importance in immune system regulation" ppsx
... TCR, T cell receptor; Th, T helper cell; Treg, T regulatory cell 21 Competing interests The authors declare that they have no competing interests 22 Acknowledgements This work is supported by ... degradation Science 20 03, 3 02: 121 8- 122 2 13 Saito T, Yokosuka T: Immunological synapse and microclusters: the site for recognition and activation of T cells Curr Opin Immunol 20 06, 18 :30 5 -31 3 14 ... pathogenic infection and, in its activated form, could interact with a Jury and Kabouridis Arthritis Research & Therapy 20 10, 12: 205 http://arthritis-research.com/content/ 12/ 2 /20 5 Page of Antigen...
- 7
- 357
- 0
Báo cáo y học: " Systemic T-helper and T-regulatory cell type cytokine responses in rhinovirus vs. respiratory syncytial virus induced early wheezing: an observational study" pps
... 105 (36 ): 135 62- 135 67 Page of 10 (page number not for citation purposes) Respiratory Research 20 09, 10:85 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Hoebee B, Rietveld E, Bont L, Oosten ... infections [17 ,30 ] Furthermore, Th2-type cytokines could counteract Th1-type cytokines, and thereby, may increase susceptibility to more severe RV-infections [ 12, 15,17 ,25 ] In agreement, the RV ... possible that RV-infection worsens Th2-type inflammation, the presence of Th2-type cytokines more likely may reflect a chronic inflammatory state of lower airways, which may increase susceptibility to...
- 10
- 351
- 0
Báo cáo y học: "Association between the PTPN22 +1858 C/T polymorphism and psoriatic arthritis" docx
... our results are consistent with those reported for the Toronto population by Butt et al., but are in contrast with the others cited This could indicate that association with PTPN 22 exists in specific ... shows the demographic data and phenotype of the patients at the time of the study Genotyping DNA from the patients and controls was extracted from ethylenediamine tetraacetic acid-treated whole ... Association and from the Västerbotten County Council Authors’ contributions KJ, the main investigator, carried out the genotyping together with MJ, performed laboratory and statistical analysis, and...
- 4
- 281
- 0
Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx
... inhibitor T- 20 is modu- http://www.retrovirology.com/content/6/1/ 43 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 lated by coreceptor specificity defined by the V3 loop of gp 120 J Virol 20 00, ... rats were stimulated with anti-rat-CD3 and anti-rat-CD28 day and peaked days after stimulation (Fig 5B) Interestingly, rat splenocytes stimulated with phytohemaglutinin (PHA) and IL -2 did not ... (gccaacgctcaatccggttctcgc) and CTGB3 (gctattttccagctgttctcgagtg) were used for the 5' end Primers CTB4 (ttattccctagtccaaggatgac) and CTGB4 (cagacaatagactatcaagacactgtg) were used for the 3' end PCR was performed...
- 12
- 357
- 0
Báo cáo y học: "The relationship between CD4+CD25+CD127regulatory T cells and inflammatory response and outcome during shock states" potx
... different between patients and healthy volunteers throughout the study period, patients with shock presented with constantly decreased NK absolute To get further insight in to the role of Tregs during ... collected on citrated tubes Sampling was repeated at day three, five and seven provided that the patient was still in the ICU Flow cytometry Flow cytometry analyses were conducted on a Coulter Cytomics ... severity and cytokines plasma concentrations Considering the correlation between Tregs and outcome, at least in septic patients, we evaluated the relation between these cells and severity Indeed, there...
- 11
- 281
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25