1 workingfor the railway station a very long time he was standing in one of the big railway 2 stationsin london one morning waiting for travelers to ask him to carry them with their luggage when he 3 sawa small man running towards the trains with a bag

Báo cáo sinh học: " Imperfect DNA mirror repeats in the gag gene of HIV-1 (HXB2) identify key functional domains and coincide with protein structural elements in each of the mature proteins" doc

Ngày tải lên : 18/06/2014, 18:20

... 28 28 27 27 26 24 25 25 25 25 24 24 23 23 23 22 22 22 21 21 21 20 20 19 19 18 18 18 17 16 21 21 21 21 21 20 20 20 20 16 NC CA MA NC MA MA MA p6 MA MA MA MA CA CA CA CA CA CA CA CA CA NC MA CA ... 97 14 08 21 2 22 6 27 4 25 9 11 18 644 11 00 515 11 31 409 918 988 10 51 6 73 10 66 6 12 9 53 12 97 33 733 11 30 21 155 17 0 12 8 34 6 63 18 4 11 2 15 6 33 7 38 3 82 585 667 696 967 10 59 8 51 929 946 13 25 13 34 $1- gag ... 0 8 12 -at ta-0887 0 920 -ag ga-0994 029 9-ct ac- 03 72 030 3-ag ca- 037 3 0985-ga ag -10 53 05 43- ca aa-0606 0 810 -aa aa-08 73 13 62- gc ag -14 25 026 5-ca ac-0 32 7 12 09-aa aa - 12 67 11 53- aa ca -11 99 0 91- RI DT - 12 2 248-GW...

13
538
0

Should The U.s. Army Adopt New Policies And Procedures For Responding To Emergency Ammunition Demands potx

Ngày tải lên : 23/03/2014, 12:20

186
403
0

comptia a+ certification all-in-one desk reference for dummies

Ngày tải lên : 25/03/2014, 15:21

... better then when I originally wrote them In addition to them, I would like to thank the rest of the staff at Wiley Publishing who worked behind the scenes taking care of many of the details that are ... Prepare for the Exams 13 Making Arrangements to Take the Exams 14 The Day the Earth Stood Still: Exam Day 14 Arriving at the exam location .14 Taking the exam 15 ... case there are any delays It is also not so long that you will have time to sit and stew about the exam Get there, get into a relaxed frame of mind, and get into the exam The Day the Earth Stood...

1.2K
423
1

The everyday internet all in one desk reference for dummies wiley

Ngày tải lên : 27/03/2014, 01:40

... E-Mail Messages 21 1 Writing an e-mail message 21 1 Replying to and forwarding e-mail messages 21 3 Sending a file along with a message 21 3 Sending a picture along with a ... narrowing a search . 12 7 Searching the “Invisible Web” 13 2 Evaluating Whether Information at a Web Site Is Valid 13 2 Chapter 4: Advanced Tools for Scholars and Researchers 13 5 Discovering ... ruthasawa.com: The domain name of the Web site to connect to is ruthasawa.com The next section in this chapter explains what domain names are and how computers use them to locate computers on the...

627
1.5K
0

The everyday internet all in one desk reference for dummies

Ngày tải lên : 27/03/2014, 01:46

... E-Mail Messages 21 1 Writing an e-mail message 21 1 Replying to and forwarding e-mail messages 21 3 Sending a file along with a message 21 3 Sending a picture along with a ... narrowing a search . 12 7 Searching the “Invisible Web” 13 2 Evaluating Whether Information at a Web Site Is Valid 13 2 Chapter 4: Advanced Tools for Scholars and Researchers 13 5 Discovering ... ruthasawa.com: The domain name of the Web site to connect to is ruthasawa.com The next section in this chapter explains what domain names are and how computers use them to locate computers on the...

627
160
0

Linux all in one desk reference for dummies phần 1 pot

Ngày tải lên : 23/07/2014, 23:20

... 20 9 Loading data into a table 21 0 Querying the database . 21 1 Multimedia Applications 21 1 Using a digital camera . 21 2 Playing audio CDs 21 3 Playing ... init command 3 61 Understanding the Linux startup scripts .3 62 Manually starting and stopping servers 36 3 Automatically starting servers at system startup 36 3 Taking Stock of Linux ... began life as a 19 98 release of Red Hat Linux with an easy -to- use installer and with KDE as the default desktop Mandrake Linux is freely available Mandrake software packages use the Red Hat Package...

75
284
0

Java All-in-One Desk Reference For Dummies phần 1 pptx

Ngày tải lên : 12/08/2014, 19:21

... Java programs The Java compiler doesn’t translate Java into the machine language of the computer the program is run on Instead, the compiler translates Java into the machine language of the Java ... class library, called the Java API, is as much a part of Java as the language itself In fact, the real challenge of learning how to use Java isn’t learning the language; it’s learning the API The ... compiled to the machine language of JVM rather than the machine language of an actual computer platform ✦ I didn’t make up the Olivetti Programma 10 1 It was a desktop computer made in the early 19 60s,...

89
225
0

A study on non-majors' motivational factors in learning English listening at Hai Phong Private University= Nghiên cứu về những yếu tố ảnh hưởng đến hứng thú học

Ngày tải lên : 28/03/2015, 09:08

... and auditory images and the left brain is associated with logical, analytical thought, with mathematical and linear processing of information Ambiguity tolerance: the person who is tolerant of ambiguity ... is the reason for the learners’ great ambition, high demanding for challenges, proficiency Goal orientation: the learners are very aware of the goals of learning and direct their efforts towards ... 2% 1% 0% 0% 25 39 36 31 11 1 34 % 35 % 49% 28 % 15 % 4% 1% 1% 1% Table 7: Teachers’ behavior factor Statement 22 : I like my teacher of English to encourage me to listen According to the table, the...

58
999
1

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Ngày tải lên : 26/10/2012, 09:39

... Lorenz, and Heinz Fleischhacker for their dedication and their technical assistance in the development of this concept Conflict of Interest 27 10 11 12 13 14 15 16 17 18 19 The authors have declared ... is available for DARinv In order to obtain reaction times in the range of minutes for the DARinv, the reactivity of the dienophile is decisive for the rapid reaction process besides the reactivity ... TMZ-diaryl-tetrazine 12 a diene compound poised for 23 the DARinv The corresponding NMR H spectra are shown in the figures 2- 5 Table (Schema 3) Synthesis of the Temozolomide derivative 12 capable for...

10
623
0

A study on the techniques for the improvement to the teaching of oral skills in light of communicative english language teaching for junior high school teachers in quang ngai province part 1

Ngày tải lên : 07/11/2012, 14:41

... 46 45 43 43 37 37 34 32 32 31 30 29 27 26 26 24 22 22 21 21 21 13 2. 6 .2. 5 Remarks about Class Observations Class observations show the methods and techniques used by the observed teachers • Methods ... - ADAPTING THE DIALOGUE TO THEIR LIVES (Using prompts) Explain to the students that they are going to the dialogue again in pairs, using their own information This time the teacher is going to ... welcome The teacher puts the dialogue chart on the board The teacher elicits the exchanges from students and asks them to repeat The teacher asks a pair to demonstrate the dialogue (open pair) The...

48
1.3K
7

The meaning of life: A very short introduction

Ngày tải lên : 11/01/2014, 18:45

... knowing whether to try and change them or to keep them more or less as they are Knowledge is an aid to happiness rather than its antagonist 19 Questions and answers To ask about the meaning of ... steady haemorrhaging of public meaning, the more it was driven into various ugly forms of fundamentalism Or if not that, then 22 A ‘New Age’ gathering at Stonehenge The Meaning of Life into New ... betrayal of the intelligentsia The more the humanities were harnessed to the needs of the economy, the more they abandoned the business of investigating fundamental questions; so the more the Tarot touts,...

129
529
0

Tài liệu TNXH 1 - BÀI 1: CƠ THỂ CHÚNG TA A. Mục tiêu: -Kiến thức : Kể tên các bộ phận chính của docx

Ngày tải lên : 21/01/2014, 10:20

... em thi đua nói Hoạt động 2: Quan sát tranh *Mục tiêu:Nhận biết hoạt động -Từng cặp quan sát thảo luận phận bên thể gồm ba phần chính:đầu, mình,tay chân *Cách tiến hành: Bước 1: Làm việc theo nhóm ... 3. Bài mới: Hoạt động GV Hoạt động HS Giới thiệu : Ghi đề Hoạt động 1: Quan sát tranh *Mục tiêu:Gọi tên phận bên thể *Cách tiến hành: -HS làm việc theo hướng dẫn GV Bước 1: HS hoạt động theo ... -HS theo dõi -GV hỏi:Cơ thể ta gồm có phần? -1 HS lên làm mẫu *Kết luận: -Cả lớp tập -Cơ thể có phần:đầu,mình,tay chân -Chúng ta nên tích cực vận động.Hoạt động giúp ta -HS nêu khoẻ mạnh nhanh...

5
978
0

The Elements: A Very Short Introduction

Ngày tải lên : 20/02/2014, 16:46

... debate a non-Aristotelian theory of the elements at the house of Parisian nobleman Francois de Soucy in August 16 24 was squashed by a parliamentary order, leading to the arrest of its ringleader The ... was the central belief of alchemy If metals may indeed be interconverted one to another in the deep earth, perhaps the alchemist could find a way to accelerate the process artificially and make ... that the calx releases this fixed air when 'reduced' back to metals with the agency of charcoal and heat Hearing of Black's fixed air in 17 73, he decided that this was what metals combine with...

193
283
0

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Ngày tải lên : 07/03/2014, 03:20

... expression of pro -in ammatory mediators is probably a result of the fact that in ammatory transcription factors such as nuclear factor-kappaB, activator protein -1 and nuclear factor of activated T-cells ... of poly(ADP-ribose) polymerase Trends Pharmacol Sci 27 , 626 – 630 30 Alano CC & Swanson RA (20 06) Players in the PARP -1 cell-death pathway: JNK1 joins the cast Trends Biochem Sci 31 , 30 9– 31 1 31 ... years ago in liver cell nuclei incubated with NAD and ATP in Paul Mandel’s laboratory in Strasburg [24 ] Although this seminal observation was made in a neuroscience laboratory, for the following...

10
417
0

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20

... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 37 36 controlled by an arabinose promoter [26 ], was achieved as visualized by heme staining of SDS ... kinetics approach, which has the advantages of: (a) maintaining the complete electron transport chain used during metal respiration; and (b) keeping the terminal reductases in their native cellular...

11
731
0

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Ngày tải lên : 08/03/2014, 08:20

... 12 50 ± 50 24 ± 11 30 ± 37 0 4.8 ± 1. 2 290 ± 74 40 ± 36 0 ± 55 >10 000 >10 000 0 . 13 10 0 . 13 3. 8 3. 7 3. 0 0.07 4.6 0.0070 3 .2 0.54 2. 3 24 0 23 0 1. 0 37 0.7 5.5 3. 0 1. 2 0.6 2. 5 0.69 2. 0 2. 0 2. 9 21 5 21 0 ... Biol 22 2, 31 1 33 3 Sagan, S., Karoyan, P., Chassaing, G & Lavielle, S (19 99) Further delineation of the two binding sites (Rn*) associated with tachykinin neurokinin -1 receptors using [3- prolinomethionine ... sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK -1 and NK -2 receptors [HGly8] NKA(4 10 ) is as potent as NKA and [Ala8]NKA on rabbit pulmonary...

11
860
0

A simple large scale synthesis of very long aligned silica nanowires

Ngày tải lên : 16/03/2014, 15:03

... a long alumina plate (35 cm in length and 30 mm in width) to act as the starting material and growth substrate After transferring these wafers together with the alumina plate into the tube (one ... end of the plate was at the center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of Â 10 2 Torr The furnace ... position was measured by a movable thermocouple mounted inside a thinner alumina tube that was inserted into the larger tube One end of the thinner tube was closed and located at the center of the...

5
524
0

Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

Ngày tải lên : 16/03/2014, 18:20

... 20 1. 2 (1. 24 1. 20 ) 14 14 02 (11 874) 21 7 81 ( 21 0 9) 10 0.0 (99.8) 39 .6 (2. 6) 4.6 (55.9) CNS 1. 1 7868 ( 633 ) 0 .16 9 (0 .26 6) 0 .19 0 (0 .27 3) 0. 017 1. 8 27 1. 3 97 .1 2. 9 17 .7/ 3 12 22 .8/ 32 2 34 .3/ 67 SHELX-97 20 948 ... 10 2 12 7 3. 0 2. 0 1. 6 1. 6 1. 5 1. 5 1. 2 1. 2 1. 2 ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A R/Rfree 0.464 0 .33 9/0 .3 71 0 .19 0/0 .22 4 0 .16 9/0 .19 0 0.409 0 .37 5 0 .19 1/0 .20 5 0 . 13 3/ 0 .19 0 0 .11 9/0 .18 5 Ó FEBS 20 04 4 12 0 ... contact interfaces The total areas buried by the lattice contact interfaces are ˚ ˚ ˚ 3 4 12 A2 in type I crystal (1. 6 A) and 2 21 1 A2 in type II ˚ ), whereas the molecular surface areas of the crystal...

9
441
0

Báo cáo khoa học: Solution structure of long neurotoxin NTX-1 from the venom of Naja naja oxiana by 2D-NMR spectroscopy pot

Ngày tải lên : 23/03/2014, 13:20

... C., Lange, G., Pal, G.P., Wilson, K.S., Maelicke, A & Saenger, W (19 91) The reﬁned crystal structure of a- cobratoxin 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 ˚ from Naja naja siamensis ... 6C the crystal and the average of NMR structures are superimposed over the backbone atoms The RMSD ˚ for the backbone atoms of the b-sheet part is 0. 72 A, indicating nearly identical conformation ... siamensis at the 2. 4 A resolution J Biol Chem 26 6, 21 5 30 – 21 5 36 Dewan, J.C., Grant, G .A & Sacchettini, J.C (19 94) Crystal ˚ structure of a- bungarotoxin at 2. 3 A resolution Biochemistry 33 , 13 147 13 154...

8
411
0