1 of 1 fig02 24 cpp output 1 of 1
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... isoallergen of a major Bermuda grass pollen allergen, Cyn d J Biomed Sci 10 , 11 1 11 9 10 Su SN, Lau GX, Yang SY, Shen HD, Tsai JJ & Han SH (19 90) Isolation and partial characterization of Bermuda ... 402, 16 7 17 2 6226 L.-P Chow et al 17 Focke M, Hemmer W, Hayek B, Gotz M & Jarisch R (19 98) Identification of allergens in oilseed rape (Brassica napus) pollen Int Arch Allergy Immunol 11 7, 10 5 11 2 ... glycoallergens J Biol Chem 275, 11 4 51 11 458 Kurosaka A, Yano A, Itoh N, Kuroda Y, Nakagawa T & Kawasaki T (19 91) The structure of a neural specific carbohydrate epitope of horseradish peroxidase recognized...
- 10
- 665
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... A., Yoshida, K., Nicolin gene (NICN1) (Eur J Biochem 269) 5245 10 11 12 13 14 Hasegawa, Y., Kawaji, H., Kohtsuki, S & Hayashizaki, Y (20 01) Functional annotation of a full-length mouse cDNA collection ... three species, the encoded NICN1 protein consists of 213 amino acids and has a calculated molecular weight of 24 kDa (Fig 1) The amino acid sequences of the NICN1 proteins are 94% identical between ... 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG Exon 5¢-splice site aaacgttatgtggccTGGGAG … 13 3 (exon 1, 234 bp) tcgtttgtattctagTTGCAG … 310 tggtatgtgtgtcagATGCTG … )10 2 424 gcctttgctttgcagAGCCCC...
- 6
- 450
- 0
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt
... Aids 2002, 16 (18 ):2399 -240 7 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Page 12 of 13 (page number not for citation purposes) Journal of Immune ... contributions 93 83 91 8B 99 15 0 42 7C 359 315 6A Mean ± sem Median (Range) Week 12 http://www.jibtherapies.com/content/6 /1/ 7 13 8 206 ± 56.6 603 ± 3 21. 3 433 ± 17 8.2 347 ± 19 9.9 11 1 12 7 203 93 (15 –536) (8–3926) ... 625 452 307 220 55 4B 16 ND 536 3C ND 17 476 2C 11 1 1B 46 50 52 223 10 3 35 56 12 12* 750* ND 3926* 18 30* 2277* 27 336* All authors have read and approved the final version of this manuscript NI...
- 13
- 359
- 0
International journal of computer integrated manufacturing , tập 24, số 1, 2011
... 0.000 1. 244 2 0.8 914 0.8 917 0. 817 8 1. 4846 1. 3077 0.7372 1. 2272 0.9988 1. 5260 1. 4 510 1. 16 81 1 .11 30 0.3 918 1. 62 81 0.9707 1. 6257 0.8072 14 13 15 17 11 10 18 12 16 10 14 14 16 11 12 17 15 13 13 8 10 12 ... index (%) 13 3 24 28 24 11 53 10 19 12 33 34 10 0 99.79 10 0 10 0 99.83 96.59 10 0 10 0 99. 91 97.54 99.95 99.85 99.97 91. 89 99.99 10 0 99.99 99.36 249 643 714 18 09 238 2 41 1404 984 6 41 588 2 41 567 567 ... variety Quality of distance Delivery 10 11 12 13 14 15 16 17 18 0.02 0.23 0.04 0.04 0.44 0.52 0.00 0.44 0 .19 1. 00 0 .17 0 .12 0.35 0. 21 0.62 0.02 0.63 0 .15 1. 00 0.97 1. 00 1. 00 0.98 0.58 1. 00 1. 00 0.99...
- 94
- 333
- 0
Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf
... published in print format 2004 isbn -13 isbn -10 978-0- 511 -19 430-6 eBook (EBL) 0- 511 -19 430-7 eBook (EBL) isbn -13 isbn -10 978-0-5 21- 6 616 0-7 hardback 0-5 21- 6 616 0-9 hardback Cambridge University Press ... chapter (See the trees of logical dependencies of chapters and 6.) 34 32 Chapter 33 31 30 29 27 28 26 25 24 23 21 Interlude: Ch 4: Ch 3: 18 19 20 14 13 23 Ch 1: 44 43 41 42 40 38 39 36 37 35 ... practice of For further discussions of the Arabic traditions, see Lorch (19 89), Sesiano (19 91) Pappus V, Hultsch (18 76–78) I.352–58 13 14 i n t ro d uc t i on sending out enunciations without proofs...
- 387
- 1,245
- 3
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... 12 7.63 12 .68 10 4.75±20.55 Diabetic control group 300.63 10 4.69a 244 .13 10 7.03b 222.75 10 4. 81 b 2 01. 38± 91. 64 b 209.50±87. 61 a 203.75 10 0.30 a 18 0.25 11 1.82 b Diabetic treated group 294 .13 ±89.97a ... Foundation of China (No: 306 710 07, 3030 016 5) and the grant from the Traditional Chinese Medicine Administration of Zhejiang Province, China (No: 2 010 ZB075) 209 10 11 12 13 14 15 16 17 Chen J, ... 208 .13 ±76.43 17 0.00±76. 91 1.5h 98.38 24. 44 15 0 .13 ±56.23 2h 93.88±30.70 13 0.63±47.67c 2.5h 76.75±33. 01 92.63±46 .12 d 3h 75.38±34.99 87.88±46.76 c a Compared with normal control group P
- 7
- 612
- 0
Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"
... 19 8 a LPS +1, 25 vit-D 208 ± 214 a 12 ,0 ± 0,2 12 ,2 ± 0,7 11 ,4 ± 0,4 a 12 ,0 ± 0,4 53 ± 53 ± 12 4 ± 16 7 94 ± 24 a 0,68 ± 0,29 0,62 ± 0,27 1, 77 ± 1, 10 2 ,12 ± 0,53 a 41 ± 46 ± 19 44 ± 57 ± 11 8,2 ± 0,5 ... 6 31 ± 48 Shamoperation + 1, 25 vit-D 5 51 ± 53 CLP +vehicle CLP + 1, 25 vit-D 647 ± 95 Control + 1, 25 vit-D 606 ± 13 9 418 ± 49 b 515 ± 53 c 12 ,0 ± 0,2 12 ,2 ± 0,7 11 ,4 ± 0,6 11 ,0 ± 0,8 12 ,5 ± 1, 2 12 ,7 ... (mmol/L) 19 3 1, 27 ± 0,35 1, 27 ± 0 ,13 2,66 ± 0,65 a 3,26 ± 0,60 a 55 ± 62 ± b 76 ± a 10 3 ± 19 a,b 6,3 ± 1, 1 7,8 ± 0,7 11 ,8 ± 0,8 a 13 ,3 ± 1, 0 a,b 1, 34 ± 0,02 1, 42 ± 0,05 b 1, 24 ± 0,04 a 1, 28 ± 0,04...
- 6
- 505
- 1
Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"
... 0.09-0. 71) aSex-age-adjusted b n GA (%) ORa(95%CI) 17 1 74 79 250 85 (49.7) 48 (64.9) (80.0) 52 (65.8) 13 7 (54.8) 1. 00 (Reference) 1. 87 (1. 06-3.29) 4 .24 (0.45-39.7) 1. 95 (1. 12-3.40) 49 23 12 1 55 248 ... 0.08-0. 71) Twenty-one of the 204 seronegative healthy controls (10 %) had atrophy, which were considered as the loss of H pylori infection following n 317 11 9 18 13 7 The combination of Gab1 and PTPN11and ... (OR =1. 95, 95% CI 1. 12 -3.40) Seropositive individuals with the PTPN 11 G/G and Gab1 G/A+A/A demonstrated the highest risk of gastric atrophy with significance relative to PTPN 11 G/A+A/A and Gab1...
- 6
- 541
- 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... objectively in a complementary manner, via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing Remarks Each of the specific components of the Event-Related Potential discussed in this ... Behavior 19 94; 56: 511 - 516 66 Tarkka IM, Stokic DS Source localization of P300 from oddball, single stimulus, and omitted-stimulus paradigms Brain Topography 19 98; 11 :14 1 -15 1 67 Polich J, Hoffman ... manifestation of context updating? Behavioral and Brain Sciences 19 88; 11 :357-374 58 Mccarthy G, Donchin E A metric for thought: a comparison of P300 latency and reaction time Science 19 81; 211 :77-80...
- 8
- 563
- 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
... A589G_G590C T100G_C102A T100G_C102A T205G_C206A 18 8 -19 0 18 8 -19 0 18 8 -19 1 18 8 -19 1 RKT RKT RKTT RKTT PKA PKC PKC PKA A568G_C569A_A570C A568G_C569A_A570C A571G_C572A A571G_C572A 18 9 -19 2 KTTS [R/K]X[pS/pT] ... Meltzer P., Morin P.J., and Weeraratna A.T Claudin -1 overexpression in melanoma is http://www.medsci.org Int J Med Sci 2009, 6 10 11 12 13 14 15 16 17 18 regulated by PKC and contributes to melanoma ... Int J Med Sci 2009, AMINO ACID SEQUENCE 18 8 -19 0 RKT 18 8 -19 1 RKTT 18 8 -19 1 RKTT 97 MOTIF (PO4) PKA/PKC DNA BASE CHANGE PRIMER PKC PKC PKA A568T A571G A571G R: 5'-gttgggtaagaggttgattttcggggacaggaaca-3'...
- 9
- 592
- 0
Heku: Book 1 of the Heku Series
... House 58 Control 80 Fight 91 Island Coven 10 2 Choices 13 7 Trust 15 9 Beginning 18 6 Bonding 2 01 Recovery 2 21 Coming Out 242 Alone 256 Returning 280 Training 296 Potential 317 Meeting “Ms Russo?” he ... 2 010 All rights reserved, including the right to reproduce this book, or portions thereof, in any form whatsoever Manufactured in the United States of America Table of Contents Meeting Keith 13 ... minutes, he saw the large herd of Angus cattle they were heading towards Emily was a few yards ahead of him so he studied her again In the heat, she pulled her hair back off of her neck briefly and...
- 11
- 365
- 0
Anti-Supernatural Assault Team- Book 1- The Seal of Solomon- Part 1
... the end of the world in 2 012 Book tells the story of five pieces of the Seal of Solomon Book 1- Part 1- The Beginning of an End October 1, 2 012 81 days remaining Another plane landed on the San ... They consist of best people, Arthur could find Their main aim is to find pieces of the Seal of Solomon, so they can stop the demon that is responsible for the end of the world in 2 012 Book tells ... 0, which is simply a story of each member Book takes place a few days after Book ends and covers time between October and December 19 , 2 012 “Take, O Solomon, king, son of David, the gift which...
- 18
- 484
- 1
Of The Heart (Solstice Saga - Book 1)
... information storage retrieval system, without the written permission of the author www.jblenkush.com ISBN: 14 69902958 ISBN -13 : 978 -14 699029 51 To my wife, NJ, whose “touch” rejuvenates my life-force A ... Decisions of that sort make her the adult of our pair in my eyes and a promising leader Of course it doesn’t hurt she has a driver’s license and, more important, access to a car As we drive out of ... to nourish in the morrow And what shall we say of the mountain dwellers? Those who reap the essence of the mountain, who practice the ancient art of vampirism, transferring and manipulating life-force...
- 18
- 375
- 0
Statnamic testing of piles in clay 1
... tests in Bed (B1 /1/ CRP-0. 01 and B1/4/STN -15 ) Figure 6 .12 Application of Balderas-Meca’s model for pile load tests in Bed (B1 /1/ CRP-0. 01 and B1/4 /STN -15 ) Figure 6 .13 Application of Gibson and ... B5 /15 /CRP-0. 01 and B5 /14 /CRP -10 0 Figure 6 .10 Application of Gibson and Coyle’s model for pile load tests in Bed (B1 /1/ CRP-0. 01 and B1/4/STN -15 ) Figure 6 .11 Application of Randolph and Deeks’ model ... in Bed (B5 /15 /CRP-0. 01 and B5 /14 /CRP -10 0) xv Figure 6 .24 Application of Balderas-Meca’s model for pile load tests in Bed (B5 /15 /CRP-0. 01 and B5 /14 /CRP -10 0) Figure 6.25 Application of Equation...
- 164
- 567
- 0
Numerical analysis of externally prestressed concrete beams part 1
... [K 11 ] 1 ({ΔF1 } + {R1 } − [K 21 ]{ΔU }) (2.22) {ΔF2 } = [K 22 ]{ΔU } + [K12 ]{ΔU } − {R2 } (2.23) K 12 ⎤ K 22 ⎥ ⎦ ⎧ ΔU ⎫ ⎬ ⎨ ⎩ΔU ⎭ (1) ⎧ ΔF ⎫ ⎧ R ⎫ = ⎨ 1 +⎨ 1 ⎩ΔF2 ⎭ ⎩ R2 ⎭ ⎡ K 11 ⎢K ⎣ 21 Solving ... ∑ j =1 Ts Li [12 L (r i j +1 − r j ) − (30 L2 − 72 K j )(r j2 +1 − r j2 ) + 24 Li ( r j3 +1 − r j3 ) i [ M ] ] EI (16 L4 + 13 2L2 K j + 14 4K )(rj +1 − rj ) − (24L3 + 72K j Li )(rj2 +1 − rj2 ) + 12 L2 ... P1 ⎫ ⎡ K c 11 ⎪Q ⎪ ⎢ ⎪ 1 ⎢ ⎪M1 ⎪ ⎢ ⎪ ⎪ ⎨ ⎬=⎢ ⎪ P2 ⎪ ⎢ ⎪ Q2 ⎪ ⎢ ⎪ ⎪ ⎢ ⎪M ⎪ ⎢ ⎩ ⎭ ⎣ K c12 K c13 K c14 K c15 K c 22 K c 23 K c 24 K c 25 K c 33 K c 34 K c 35 K c 44 K c 45 Sym K c 55 K c16 ⎤ ⎧ u1...
- 96
- 510
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25