1 customer agent find and select the best suitable facilitator agent for a particular order
Intelligent Control and Computer Engineering
... u(t) for {Ar = A 11 − A1 2 A 1 A 21 , Br 22 −C2 A 1 B2 } 22 = B1 − A1 2 A 1 B2 , Cr 22 (29) (30) = C1 − C2 A 1 A 21 , Dr 22 = A. N Al-Rabadi Neural Estimation with Linear Matrix Inequality-Based Transformation ... between the space robot and moving target T Kobayashi ( ) The corse of Aerospace, School of Engineering, Tokai University, 11 17 Kitakaname Hiratsuka, Kanagawa, 259 -12 92 Japan e-mail: 9amjm005@mail.tokai-u.jp ... Canberra, Aust Capital Terr Australia xu.huang@canberra.edu.au Oscar Castillo Tijuana Institute of Technology Computer Science Tijuana Mexico publication@iaeng.org e-ISSN 18 76 -11 19 ISSN 18 76 -11 00...
- 328
- 585
- 0
Báo cáo hóa học: " Research Article A T-S Fuzzy Model-Based Adaptive Exponential Synchronization Method for Uncertain " docx
... functions are h1 ω 1 x1 t d , h2 ω x1 t 1 d 4.4 Journal of Inequalities and Applications 11 30 20 10 10 −20 Time s 10 10 10 x1 x1 ˆ a 30 20 10 10 −20 −30 Time s x2 x2 ˆ b 50 40 30 20 10 0 Time ... 2-3, pp 10 9 11 6, 2002 14 Y.-C Tian and F Gao, “Adaptive control of chaotic continuous-time systems with delay,” Physica D, vol 11 7, no 1 4, pp 1 12 , 19 98 15 J H Park and O M Kwon, “Guaranteed ... Takagi and M Sugeno, “Fuzzy identification of systems and its applications to modeling and control,” IEEE Transactions on Systems, Man and Cybernetics, vol 15 , no 1, pp 11 6 13 2, 19 85 22 K Tanaka and...
- 14
- 270
- 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt
... complementary pairs for positions 9, 10 , 12 , 15 , 16 , 19 and 20 is less "important" than for the positions 11 , 13 , 14 , 17 and 18 This result can be validated against a recent study that investigated Watson-Crick ... (10 ) miR -14 1, (11 ) miR-202, (12 ) miR -14 8, (13 ) miR -10 6b, (14 ) miR -13 4, (15 ) miR -10 6, (16 ) miR -14 4, (17 ) miR -15 1, (18 ) miR-384, (19 ) miR -10 1, (20) miR -14 2, ( 21) miR -12 9 and (22) miR -12 6 The position ... forTargetScanS, a the targets The B Comparison area the predictions specific to and the black HuMiTar The white area shows overlap area predictions and NBmiRTar indicated at number of Comparison of the...
- 12
- 621
- 0
Báo cáo khoa học: "Multilingual Transliteration Using Feature based Phonetic Method" docx
... number of candidates for each target language is presented in Table Language 12 ,466 Chinese 6,2 91 Hindi 10 ,16 9 Korean Rank Arafat *1 Script Romanizati on 阿拉法特 拉法地奥 拉维奇 a- la-fa-te la-fa-di-ao la-wei-qi ... words and the top three ranking candidates among all of the potential target-language candidates were given in Tables 4, Starred entries are correct 11 6 Since the evaluation data obtained from the ... explained in detail in part 3 .1 c For every phoneme pair (p1, p2) in the aligned pronunciations, a feature xi has a ‘ +1 value or a ‘– 1 value: xi = +1 when p1 and p2 have the same values for...
- 8
- 171
- 0
Báo cáo khoa học: "Designing a Task-Based Evaluation Method ology for a Spoken Machine Translation System" pot
... C .A. Kamm, and A. Abella 19 97 PARADISE: A framework for evaluating spoken dialogue agents Technical Report T R 97.26 .1, AT and T Technical Reports D.Gates, A. Lavie, L.Levin, A. Waibel, M.Gavalda, ... focus on whether goals are communicated, rather than whether they are achieved Goals of a Task-Based Evaluation Methodology for an MT System The goal of a task-based evaluation for an MT system ... translation task We need to be able to account for the average goal complexity per speaker turn in a dialogue and scale the above metric accordingly; if dialogues A and B have the same score according...
- 4
- 365
- 0
Báo cáo " ENVIRONMENTAL EDUCATION BY PROBLEM BASED LEARNING METHOD (PBL) - BENEFITS AND REMAINING ISSUES - APPLY IN TEACHING CLEANER PRODUCTION SUBJECT IN HO CHI MINH CITY UNIVERSITY OF TECHNOLOGY " pdf
... smaller parts They will find out the relevant parts and simpler to understand how they work together like Example: They may be separated into a clock removable parts separately In CP there are ... Develop flow charts for key audit; e) Calculate the balance of raw materials (material balance): f) Determination of loss due to waste money in production; g ) Analyze and determine the cause of emissions, ... teachers not? What makes a teacher? The individual characteristics - Sex: female teachers generally tolerant and motivate students, male teachers often follow the department - Age: In the early...
- 9
- 591
- 0
Evaluating Progress of the U.S. Climate Change Science Program: Methods and Preliminary Results pdf
... produce, and deliver authoritative and timely information about climate variations and trends and their impacts on built, social-human, and natural systems on regional, national, and global scales ... multidisciplinary/interdisciplinary approach to a particular climate change issue that addresses physical, biological, and human dimensions research and their relationships, interactions, and feedbacks, as well as the research ... committees and especially to the chairs (Thomas Wilbanks and Antonio Busalacchi) and staff (Ian Kraucunas and Paul Stern) Other colleagues who contributed substantial material or helped the committee...
- 267
- 452
- 0
Báo cáo khoa học: "A Tabulation-Based Parsing Method that Reduces Copying" docx
... Rules 77 12 4 16 8 282 473 736 11 51 1263 13 69 15 89 217 0 319 6 5246 6853 7984 9008 10 834 11 750 12 696 13 159 17 682 20999 Table 1: The grammars extracted from the Wall Street Journal directories of the PTB ... of the heap significantly, and will result in a greater number of cache misses and page swaps the new algorithm also requires an off-line partial evaluation of the grammar rules that increases the ... non-leftmost daughters remaining), EAs — an accumulator of empty categories already partially evaluated once on Rs, and RAs — an accumulator of rules already used in partial evaluation once on Es Initialize...
- 8
- 209
- 0
Shaping Women’s Health Research: Scope and Methodologies pptx
... social assistance and maintaining a large gap between rich and poor which have direct health impacts (UN 19 9 8a) The majority of Canada’s poor are women (Statistics Canada 19 95) Policies that keep ... self-evaluation may come into play 19 WORKS CITED Archibald, Linda 19 99 Creating and Aboriginal Health Institute: Inuit Report and Recommendations Ottawa: Inuit Tapirisat of Canada Archibald, Linda ... The Impact of Feminist Research in the Academy, pp 11 1 -12 9 Bloomington, IN: Indiana University Press Canadian Broadcasting Corporation 19 99 National Aboriginal Achievement Awards Aired June 13 ,...
- 22
- 347
- 0
Báo cáo khoa học: "Complementing Word Net with Roget''''s and Corpus-based Thesauri for Information Retrieval" pdf
... COLING-ACL'98, pages 768-773 Proceedings of EACL '99 Rila Mandala, Takenobu Tokunaga, and Hozumi Tanaka to appear, 19 99 Combining general hand-made and automatically constructed thesauri for information ... between and On the other hand, the similarity in each type of thesaurus does not have a fixed range Hence, we apply the following normalization strategy to each type of thesaurus to bring the similarity ... expand terms from a single automatically constructed thesarus and did not consider the use of more than one thesaurus This paper is an extension of our previous work (Mandala et al., to appear 19 99)...
- 8
- 263
- 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures
... (1) : Degradation (%) = C0 Ct A0 At u100% = u100% A0 C0 (1) where C0 and A0 are the initial concentration and absorbance of KGL, and Ct and At are the concentration and absorbance of KGL at ... one hand, the larger surface area (Table 1) in the ZnO (12 0 ºC, 17 h) sample can provide more active sites for the adsorption of KGL, and then facilitate the diffusion and mass transportation ... Firstly, as mentioned above, the ZnO (12 0 ºC) sample had a larger surface area and a greater interspace between the nanosheets than the other samples A greater interspace between the nanosheets can...
- 26
- 551
- 0
báo cáo hóa học:" Research Article A New Angle-Based Location Method Using a Forward-Link Signal" pot
... that of RLAOA 2 .1 FLAOA Measurement Model AOA location systems measure the incident angle at an array antenna Assuming that two antennas are horizontally separated by a distance d to form an array ... [14 ] It is also assumed that angle measurements are obtained using IR-UWB system with linear array antennas for RLAOA For FLAOA, an “L” shape planar array antenna is used to avoid angle ambiguity ... to the vehicle, and the x-axis is parallel to the baseline vector between two antennas in the array antenna Assuming that the vehicle is moving on a horizontal flat surface so that the roll and...
- 6
- 249
- 0
Báo cáo hóa học: " Research Article A SystemC-Based Design Methodology for Digital Signal Processing Systems" potx
... for data transformation and guards used in functionality conditions of the activation pattern, as well as the internal variables of the actor, and their initial values The values of the internal ... assess the performance of a design point: (1) by simulation and (2) by analytical methods Simulation-based approaches permit a more detailed performance evaluation than formal analyses as the behavior ... SystemCbased simulator at transaction level, performance evaluation can be done for a given application In order to cosimulate the application and the architecture, a trace-driven simulation approach...
- 22
- 428
- 0
báo cáo khoa học: " Lessons from the evaluation of the UK''''s NHS R&D Implementation Methods Programme" doc
... such as cardiovascular disease and mental health, and was largely clinically-focused, with an emphasis on randomised control trials (RCTs) as the gold standard research methodology In contrast, the ... of the media in public and professional understandings of breast cancer IMP 17 Impact of professional and managerial change agents (including educational outreach visits and local opinion leaders) ... Quantitative assessment of outputs and dissemination Data collection and analysis were informed by the HERG framework for assessing health research payback, and the various stages of that model are used...
- 13
- 294
- 0
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx
... normalization method as in [19 ], which includes base 10 log-transformation as well as normalization to mean and variance For the data that contains negative values, we not perform log-transformation ... information and only a small number of training samples are available Yao and Li Algorithms for Molecular Biology 2 010 , 5 :14 http://www.almob.org/content/5 /1/ 14 Page of 11 Nonparametric Margin ... microarray classification ANMM4CBR contains two modules, ANMM for feature selection and CBR for classification Both ANMM and CBR are suitable for dealing with microarray data, which usually contain...
- 11
- 373
- 0
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps
... Genet 19 93, 53 :11 37 -11 45 Imai HT, Wada MY, Hirai H, Matsuda Y, Tsuchiya K: Cytological, genetic and evolutionary functions of chiasmata based on chiasma graph analysis J Theor Biol 19 99, 19 8:239-257 ... and itself primers, Click andusedfile(assembly and cumulative of honeygenotyped honey bee,forcontaining sequencesize andinthename,map of colA PDFandKosambithe a microsatellite-basedthethe scaffolds ,the ... indicated: the number of markers mapped (1, 346 for family B alone, 12 8 for family V alone, 534 for both); the genetic length of the map: Haldane and Kosambi functions of distance calculated on the...
- 14
- 261
- 0
Báo cáo y học: " ngLOC: an n-gram-based Bayesian method for estimating the subcellular proteomes of eukaryote" pps
... estimated 5,653 21, 262 13 ,203 14 ,833 13 , 616 5,384 31, 320 36,059 94.79-99.82 % CYT 15 .22 14 .80 12 .74 14 .43 15 . 01 13.66 13 .44 14 .14 12 .74 -15 .22 % CSK 1. 07 1. 19 1. 05 1. 11 1. 31 1.24 1. 50 1. 48 1. 05 -1. 50 ... exact percentages of the ngLOC training data Additional data files The following additional data files are available with the online version of the paper Additional data file contains all of the ... 10 or more subcellular locations, and are freely available for offline analysis For uniformity, we used a random selection of 80% of our dataset for training and 20% for testing The overall accuracies...
- 17
- 258
- 0
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
... primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG (outer primers), and TATTATGATACCCACACCAACACC and ... Breast Breast Breast cancer adenocarcinoma (metastasis pleural effusion) Prostate metastasis Ovarian carcinoma Ductal carcinoma Breast cancer adenocarcinoma (metastasis pleural effusion) Therapies ... paper All authors read and approved the final manuscript 10 Additional data files The following additional data are available with the online version of this paper Additional data file contains supplemental...
- 17
- 424
- 0
Báo cáo y học: " Sequence-based prediction of protein-protein interactions by means of codon usage" doc
... principalPIPPrecision-recalltheS.[23] Bayesianyeast pairs standardsetand(coAdditionalperformanceforof PIC interologPICT yeast (INT),standard Click and6 00performanceyeast the thePIPfalciparumgenome, CAI Results anddataPIC,PIC-Lcut600 ... 2006, 16 :542-549 Arifuzzaman M, Maeda M, Itoh A, Nishikata K, Takita C, Saito R, Ara T, Nakahigashi K, Huang HC, Hirai A, Tsuzuki K, Nakamura S, AltafUl-Amin M, Oshima T, Baba T, Yamamoto N, Kawamura ... pairs in yeast Additional data file compares PIC, PI-RSCU, PI -A and PI-L in a figure Additional data file is a figure comparing PIP × PIC and the yeast gold standard positive set Additional data...
- 9
- 336
- 0
Báo cáo y học: " Sequence-based feature prediction and annotation of proteins" ppt
... http://genomebiology.com/2009 /10 /2/206 generalize to novel, unannotated data [2] The selection of dissimilar datasets for training, testing and validation is therefore critical to the practical usefulness of a given ... existing data has been and still is a common problem When test and validation data are too similar to the training data, the predictive performance can be grossly overestimated or completely absent ... Firestar [17 ], which is a server that integrates a database of experimentally validated functional residues with a sequence alignment analysis tool that evaluates the reliability of functional transfer...
- 6
- 187
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25