1 72 truss analysis showed the forces at joint a given in figure p1 72 determine the sequence in which the four members at joint a should be assembled to minimize the shear stress in the pin
An error analysis on the use ofcohesive devices in writing by freshmen majoring in English at thang long university
... AFFECTING LANGUAGE LEARNING On the basis of language learning process theories, it is clear that language learning bear a lot of influences and the factors affecting language learning are categorized ... helpful for the learners of a new language as they have already learned how to with that language Universal features in languages can assist learners to learn a new language On the basis of behavior ... analysis Chapter four presents the statistical results and the analysis of the data The statistical results are shown in the tables which are the basement to determine the causes of each type of...
- 62
- 1,960
- 2
Tài liệu Báo cáo khoa học: Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p pdf
... was determined spectrophotometrically using a molar extinction coefcient of 5.8 ã 10 4 M )1 cm )1 at 280 nm, which was calculated on the basis of its aromatic amino acid content [15 ] Materials and ... State University, Minsk, Belarus (details in [18 ]) Molecular modelling of HpPex5p To investigate the binding of the PTS1 peptide and correlate the data obtained from Trp uorescence analysis, a ... revealed that these strains grew on methanol at rates similar to wild-type cells (data not shown), indicating that PTS1 protein import was fully restored This indicates that the His6-tagged version...
- 7
- 548
- 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... mass of m ⁄ z 18 411 Da The pI value was estimated to be 5.9 The protein gave a pink color on PAS staining (data not shown), indicating it was a glycoprotein The yield of purified Cyn d 24 was ... allergen as pathogenesis-related proteins 13 33 53 73 93 11 3 13 3 15 3 17 3 19 3 213 233 TCC I ATC G GGC Q CAG T ACC Q CAA K AAG P CCG K AAG S TCC H CAC W TGG M ATG ACG C TGC G GGT E GAG T ACC E GAA A GCC ... E GAG A GCC T ACC L TTG A GCC Y TAC E GAG D GAC H CAC D GAC Q CAG A GCA S AGC V GTC S TCC A GCT N AAC K AAG A GCG N AAC E GAG Y TAC D GAC K AAG L CTA K AAG Q CAG L CTC G GGC G GGG E GAG E GAG...
- 10
- 665
- 0
Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot
... 5¢-CGTTCGGTGAAGCCGGCCAGC CATTCAAAGTTGTC-3¢; mutations W373K and W373K in P2, 5¢-GGGTACATGTAGATTTTTGGATTTCCCA TAG-3¢; mutations F200K and F19 3A in P2, 5¢-GCACC GACCTGGGGCTTTGACCCCAGTTCCGTAGGACGC GGAAGTAAATGTCTGGGG-3¢ ... with their substrates, based on data obtained from the Protein Ligand database (Table S1) Information obtained using the two approaches allowed us to determine the relative level of variability Analysis ... detectable enzymatic activity towards dhurrin, a natural substrate of a related b-glucosidase (SbDhr1) and a competitive inhibitor of Zm-p60 .1 These findings indicate that variations in the amino acid residue...
- 13
- 400
- 0
Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot
... et al Regulatory motifs in 4E-BP1 A C B D Fig Analysis of the binding of raptor to variants based on 4E-BP1 (A) Schematic diagram of 4E-BP1 showing the RAIP and TOS motifs, the region that binds ... features in the C-terminus of 4E-BP1 that are involved in its binding to raptor The data for the other truncation mutants shown in Fig 1C indicate that other regions of 4E-BP1 also contribute to ... importance of the proline residue in a variant of 4E-BP1 in which the arginine was mutated to alanine (AAIP, which shows modestly decreased basal and insulinstimulated phosphorylation relative to...
- 15
- 337
- 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx
... addition to the protein peaks, they also contained IAEDANS or IANBD bands, indicative of covalent binding of the dyes [19 ] Binding activities of Ag-NPA -1 Binding of fatty acids, retinol and DAUDA were ... to Ag-NPA -1, allowed calculation of the 18 5 Conformation, ligand binding and distribution of nematode protein Ag-NPA -1 average distance between these chromophores The distance approaches 1. 41 ... Ag-NPA -1 in adult A galli and comparison with that in A suum using a polyclonal antiserum raised against native Ag-NPA -1 (A) Section of A galli showing the ovary (ov) the uterus (ut) the intestine...
- 10
- 501
- 0
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc
... codes for a protein involved in the quinoline degradation pathway; oxoO is localized about kb upstream of the qorMSL genes [57] We may speculate that the degradation pathway is regulated by the XylS-type ... pBG 3a replaced by aacC1; aacC1 in the same orientation with respect to the deleted qor genes pBG4b nptII in pBG 3a replaced by aacC1; aacC1 in the opposite orientation with respect to the deleted ... 2003 Assays for Qor activity and protein content, and determination of the apparent Km and kcat values for quinoline The activity of Qor was determined spectrophotometrically by measuring the quinoline-dependent...
- 11
- 724
- 0
An analysis on the effectiveness of conversion in daily conversations Focus on English - major students at Hai Phong Private University
... knife Rake, fiddle, finger, hammer, shoulder, glue (5) To be/ act as N To nurse the baby- to be the nurse for the baby To captain the team -to act as the captain for the team Father, parrot, pilot, ... derivation relation that holds between members such as tea (n) and tea (v), as follows: Many people say that in the sentence We tead at the vicarage we have a case of a substantive used as a verb ... (The deals come and go at a dizzying pace Blink, and a hat stand is sold for $15 , an antique mahogany sewing stand and sewing machine for $30, a mahogany music box for $75) can be used in an attributive...
- 51
- 729
- 0
Economic Analysis of the House Budget Resolution by the Center for Data Analysis at The Heritage Foundation pot
... 1, 611 .2 216 .3 Millions 12 7.746 12 9 .16 0 12 7 .728 12 9 .11 9 0. 018 0.0 41 2 012 to 20 21 Economic Indicator 2 012 2 013 2 014 2 015 11 .6 11 .5 0 .1 12.4 12 .0 0.4 12 .6 12 .2 0.5 13 .0 12 .4 0.5 Yield on 10 -Year ... CDA analysts made an adjustment to the GI variable (RTXCAPGMAX) that measures the maximum marginal tax rate on capital gains given by the House Budget Committee Statutory Federal Corporate Income ... 16 , 419 .1 16, 814 .3 58.8 99.3 16 8.7 17 ,469.8 17 , 213 .2 256.6 17 ,9 61. 9 17 , 619 .6 342.3 18 ,430.8 18 ,029.7 4 01. 1 Average 16 ,262.7 16 ,11 3.2 14 9.5 14 8.340 14 7.057 1. 283 14 9.7 01 148.078 1. 623 15 1.0 21 149.077...
- 19
- 466
- 0
Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc
... approaches where information about CTL epitopes and their variants can be inferred from the sequences available for HIV -1 [27-29] The HIV sequence database has information about the viral isolates ... groups because of the limited information available regarding Vpr alleles The data generated for subtype B Vpr alleles are presented in Tables 9, 10 , 11 , 12 , 13 , 14 , 15 The analysis of subtype B involves ... on their location, may impact on their binding inhibitors targeting these enzymes The viruses containing alterations may then be able to evade the inhibitory activities of the agents and are...
- 17
- 434
- 0
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders not decrease linear to the wave force on an isolated cylinder, however ... oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio 0.2 Due to the interaction of the cylinders, the run-up profiles of the ... Cylinder Spacing 2a incident wave Y D X Wave force in x -direction acting on cylinder versus ratio a / D for ka 1. 0 incident wave Y X 2a D Wave force in x -direction acting on the cylinder in two...
- 29
- 422
- 0
Báo cáo y học: " High cell density and latent membrane protein 1 expression induce cleavage of the mixed lineage leukemia gene at 11q23 in nasopharyngeal carcinoma cell line" ppt
... 61: 4550-4555 Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S: A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD Nature 19 98, 3 91: 43-50 Sakahira H, Enari ... study, interpretation of data and writing of manuscript PHCY have been involved in the detailed experimental design, acquisition of data, interpretation of data and analysis All authors read and approved ... in cleaving the base of the chromatin loops at the nuclear matrix or scaffold, generating high molecular weight (HMW) DNA during early stage apoptosis [28] CAD was also shown to cause DNA fragmentation...
- 8
- 386
- 0
Báo cáo y học: "Characterization of the HIV-1 integrase chromatin- and LEDGF/p75-binding abilities by mutagenic analysis within the catalytic core domain of integrase" ppt
... for A1 79I) By contrast, mutants K13 6A, H17 1A, L17 2A, I18 2A and I20 3A were still able to associate with chromatin The chromatin binding affinity of F18 5A and I20 0A was reduced by approximately ... HL1 71, 2AA, EK170,3AA and HK1 71, 3AA (Fig 3A) The chromatin-association experiment showed that three of the double mutants EH170,1AA, EK170,3AA and HK1 71, 3AA displayed strong binding affinity with ... EH170,1AA, EK 17 0,3AA, HL1 71, 2AA and HK1 71, 3AA At 48 h post-transfection, cells were fractionated into chromatin-bound and non-chromatin-bound fractions as described in Materials and methods YFP-IN...
- 14
- 324
- 0
Báo cáo y học: " Therapeutic efficacy of alpha-1 antitrypsin augmentation therapy on the loss of lung tissue: an integrated analysis of 2 randomised clinical trials using computed " potx
... of CT-measured TLV and baseline measurement as covariates (statistical/endpoint analysis method) For the combined data of the integrated analysis, the study ID was added to the model as a fixed ... clinical trials of augmentation therapy with alpha -1 antitrypsin that are integrated in the manuscript, has received grant monies from Bayer and Talecris Biotherapeutics, and has participated in ... The ANCOVA model included the change from baseline to Stockley et al Respiratory Research 2 010 , 11 :13 6 http://respiratory-research.com/content /11 /1/ 136 the last CT scan as the dependent variable;...
- 8
- 257
- 0
Báo cáo y học: "The terrorist bomb explosions in Madrid, Spain – an analysis of the logistics, injuries sustained and clinical management of casualties treated at the closest hospital" potx
... condition at 21: 00 on that day, bringing the total death toll to 19 1 and the overall ‘critical mortality’ rate to 17 % According to official information, the resources mobilized to care for the wounded ... the initial chaos and emotional trauma, which are unavoidable and common to such situations There was in fact an abundance of medical teams, nursing staff and resources to treat the critically injured, ... died in the ICU at 10 :30 from bilateral lung contusion and a thoracic aorta tear A fourth victim died on that morning while undergoing damage control laparotomy The only death in a patient who had...
- 8
- 393
- 0
Báo cáo y học: " Biochemical and virological analysis of the 18-residue C-terminal tail of HIV-1 integrase" pot
... (5'-ACAGGATGAGGATTAACTGATGATAAGCTTTAGTAAAACACCATATG)/AE1065 (5'CATATGGTGTTTTACTAAAGCTTATCATCAGTTAATCCTCATCCTGTC) IN deletion mutations were subsequently constructed in pUCWTpol3stop or pKBIN6Hthr by PCR Plasmid ... (5'-PO4TCGACAGGAGATGGACAGCGGAAGTCACCTGGAGGG Page of 13 (page number not for citation purposes) Retrovirology 2009, 6:94 CGCAAGAGAGGACGGTGAGATGGCATAAG) with AE3698 (5'-PO4GATCCTTATGCCATCTCACCGTCCTCTCTTGCGCCCTC ... (5'-ACTGCTAGAGATTTTCCACACTGACTAAAA) and AE1 91 (5'-TTTTAGTCAGTGTGGAAAATCTCTAGCAG) were annealed prior to filling -in the 3' recess with [-32P]TTP (3000 Ci/mmol; PerkinElmer, Waltham, MA) using...
- 13
- 325
- 0
Báo cáo y học: "Analysis of infectious virus clones from two HIV-1 superinfection cases suggests that the primary strains have lower fitnesc" ppt
... B1.2: win Against B1.3: win B2.5 B2.3 and B2.5 replicate at similar level ex vivo Against B1 .1: win Against B1.2: win Against B1.3: win Patient P B3 .1 Against B4 .1: win B3 .1 replicates at very ... lose B1.3 Against B2.3: lose B2.3 B1.3 replicates at a lower level than B1 .1 and B1.2 ex vivo Against B1 .1: win Against B2.5: lose Destabilizing mutation in TAR hairpin CCR5 n.d CCR5 Against B1.2: ... Mutational analysis of four highly conserved aromatic amino acid residues within the Tat activation domain showed that the F32 L mutation greatly reduced Tat activity and virus replication [ 21] ...
- 15
- 319
- 0
Báo cáo y học: "Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions" docx
... catttcaccatctggttggctggctc gaagatggtgatgggatttc ctagaagcatttgcggtggacg cccgggaggtcaccatatt ctgtccattcattgtatggc aaagactagtcaagtgcagtagtgag aaaggctagtcaagtgaagcagtgg aaagccagtcaaatttagcagtggg aaaacatgcaagctagtcaagcgcg ... ggctggtccgaaggtagtga ggctggtccgagtgcagtg ggctggtccgagtgcagtg agttggtccgagtgttgtggg cctggcaggggagataccatgatcacg cttcttggccttttagctaagatc gctttgcgcagtggcagtatcg gtgctcgcttcggcagcacatatac catttcaccatctggttggctggctc ... α-tubulin1) GAPDH2) β-actin3) 7SL3) Vif hY14) hY34) hY44) hY54) U15) U25) U45) U65) reverse cacccgtcttcagggcttcttggttt gaaggtgaaggtcggagtc atggatgatgatatcgccgcg gggctgtagtgcgctatgc gatggcaggtgatgattgtgtgg...
- 11
- 238
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008