1 25 dihydroxyvitamin d3 and its analogues for the treatment of psoriasis
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... Johnson (20 01) Knight (19 98) Miller (19 98) Morkved (2002) Pages (20 01) Parkkinen (2004) Pieber (19 95) Sung (2000) Turkan (2005) Wong (20 01) C1 C2 C3 C4 1 1 1 1 3 1 1 1 1 1 1 1 1 1 2 1 2 1 1 C5 % subjects ... Duloxetine vs placebo in the treatment of stress uri- Page 26 of 28 (page number not for citation purposes) BMC Women's Health 2006, 6 :11 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ... conditions by the average practitioner for the typical patient" [12 ] Pelvic floor muscle training (PFMT) and other physical therapies for the treatment of female SUI [13 ] and UI [14 16] has been the subject...
- 28
- 738
- 0
Báo cáo y học: "1, 25-dihydroxyvitamin D3 decreases adriamycin-induced podocyte apoptosis and loss"
... control group, 1. 04±0.22, 0.79±0 .12 , 0.52±0 .13 , 0.44±0 .11 , 0. 61 0 .12 , and 0.23 ± 0.07, respectively, in the ADR group, and 0.83±0. 21, 0.95±0 .17 , 0. 31 0.09, 0.35±0 .10 , 0.34±0 .10 , and 0. 61 0 .13 , respectively, ... after 1, 25- (OH) 2D3 treatment, the number of podocytes and FPW in 1, 25- (OH) 2D3 group was higher and smaller than those in ADR group, respectively (Table and Figure 1) n 24 h UP (mg) 16 1. 01 0.29 15 ... Auto-activation of the apoptosis protein Bax increases mitochondrial membrane permeability http://www.medsci.org Int J Med Sci 2 010 , 7 10 11 12 13 14 15 16 17 18 19 20 21 22 and is inhibited...
- 10
- 463
- 0
Báo cáo khoa học: "Calcium metabolism in cows receiving an intramuscular injection of 1,25-dihydroxyvitamin D3 combined with prostaglandin F2?? closely before parturition" doc
... 9.4 1. 0 10 .7±0.80 9.4±0.6 11 .0±0.9* 8.3 1. 2 10 .8 1. 0* 8.6±0.9 11 .5 1. 0* 8.3 1. 00 8.5±0.8 9 .1 0.6 10 .0 1. 10 11 .1 1. 1** 11 .1 0.9* 10 .3±0.7* 9.6±0.5 3.3±2.0 5.8 1. 2 3.5 1. 40 6.3 1. 5* 2.5 1. 5 06.0 1. 9* ... 2.4±0.2 -1 -0.5 0.5 53.6±22 .1 52.9 14 .300 73.3±35.300 75.4±23.80 11 85.0±384 .1* 694.5±526.7** 596.6±338.4** 3 91. 4 18 8.9* 96.6 25. 9 95.8± 31. 7 95.4±23.0 57.4 16 .20 51. 9±59 .1 65.2 17 .5 45.9 11 .6 20.2 12 .5* ... function and mineral statuses in cows treated with 1, 25- dihydroxycholecalciferol and its 24fluoro analogues J Nutri 19 86, 11 6, 15 00 -15 10 Hoffsis GF, Capen, CC, Placke ME, Norman AW The use of 1, 25- dihydroxycholecalciferol...
- 3
- 223
- 1
Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2
... 15 1 Hypothetical protein - 1vhn, 2q6i, 3kyf, 3kyg, 1ofu, 2e87, 2yqz, 2hek, 2ogi, 1yre, 2d1y, 1p0h, 1q6y, 2gf6 3.358 0.2799 3 .19 7 0.2906 1emd, 3i0p, 1emd, 1hex, 1o6z, 1ur5, 3gvh, 1b8v, 1bmd, 1z2i, ... transport and catabolism 1ppv, 1p0n, 1x84, 1x83, 1vcf, 2zru Nucleotide transport and metabolism 1tls, 1ju6, 1qzf, 3k2h, 3jsu, 3cl9, 2aaz, 2blc, 1j3j, 1tvv, 1hvy, 3nrr, 1tlc, 1f28, 1sej, 1tsd, 1o26, ... 1dyh, 1vif, 1dr1, 3nrr, 1sej, 3jwf, 1ly4, 2w9s, 1qzf, 3jsu, 1d1g, 1u70, 3frd, 1ia2, 3k2h, 3. 414 0. 41 170 Dihydrofolate reductase 3ix9, 2w3w, 1bzf, 2zza, 2blc, 1dg5 Phosphoribosylglycinami de formyltransferase...
- 55
- 349
- 0
Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1
... (49.9) 14 9g 2-Thienyl$ >62.5 >62.5 14 9h 2-Pyr >10 0 (14 .9) >10 0 (5.0) 14 9i 4-CH2CH2Ph >10 0 (40.5) >10 0 (10 .4) 14 9j 4-cyclohexyl >10 0 (34.4) >10 0 (11 .8) 14 9k Isopropyl >10 0 (14 .5) >10 0 (2.8) 14 9l ... reflux, 18 h NHR' 11 3 H N N CO2Me R N N NHR' 11 5 Scheme 36: Reaction of N,N-dicyanobenzamidine 11 2 with methyl anthranilate 11 1 to yield benzofused pyrimido [1, 2-a] [1, 3,5]triazine 11 4 (11 examples) ... 2.0±0.5 14 .7 1. 3 15 2f 4-CF3C6H4 2.0 1. 9 15 .0 1. 7 15 2g 4-CNC6H4 13 .0±4.0 2.0±0.7 15 2h 2-Furyl 16 .0 1. 5 11 .1 0.9 15 2i 2-Thienyl 9.0 1. 5 10 .1 0.9 15 2j 2-Pyridyl 6.0±0.5 11 .7±0.4 *± S.D; n=3 Reference...
- 143
- 416
- 0
Báo cáo lâm nghiệp:"Stand history and its consequences for the present and future dynamic in two silver fir (Abies alba Mill.) stands in the high Pesio Valley (Piedmont, Italy)" potx
... of 19 35, 19 40, 19 55, 19 70 and 19 75 (Fig 5) In plot 1, the periods of prominent growth releases (> 10 % of the tree) took place in 19 35, 19 45, 19 50, 19 70, 19 75 and 19 95 Peak recruitment of broadleaves ... from approximately 17 0 m3 ha 1 in 19 78 to 383 m3 ha 1 in the Buscaié forest and to 332 m3 ha 1 in the Prel forest in 19 97 [18 ] After the first restoration, the second step of the forest management ... history of the high Pesio valley and the landuse of the territory were strongly influenced by the arrival of 364 R Motta and F Garbarino the Carthusian monks in 11 73 Indeed, the presence of these...
- 10
- 320
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... Y-RIT 14 .8 MBq/Kg - 11 MBq/Kg, if the platelet number was between 10 0 × 10 9/L and 14 9 × 10 9/ L, not to exceed a total of 1. 184 MBq administered as a slow i.v push over 10 minutes (Figure 1) Assessments ... in the assessment of patients with follicular lymphoma treated by ibritumomab tiuxetan Y90: multicentric study Ann Oncol 2 010 , 21: 1877 -18 83 Page of doi :10 .11 86 /17 56-9966-30 -16 Cite this article ... consolidation for the treatment of relapsed grades and follicular lymphoma: a report of cases Journal of Experimental & Clinical Cancer Research 2 011 30 :16 Submit your next manuscript to BioMed Central and...
- 5
- 287
- 0
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx
... FRANCE) for providing the Tat protein in a highly pure form, and to Michel Léonetti (CEA, Saclay, France) for the monoclonal anti-Tat 7S and 11 S antibodies References 10 11 12 13 14 15 16 17 18 19 ... ATATATTCTAGAGGTCTCTCTGGTTAGACCAGATC 3' (exon 1: for Tat1 et Tat2 :1 ) TatXbaI rev 5' TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 reverse for Tat1:← 17 18 and for Tat2:← 17 70) (11 1)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG ... (Invitrogen), and μM of the given ODN (Table 1) The mixture was heated for at 65°C and then kept on ice Next it was incubated for at 42°C and RT was added The reaction was for 50 at 42°C The same...
- 18
- 240
- 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... 1. 4 CD14 31 1.4 .1 The CD14 gene and its expression 31 1.4.2 Structure 32 1. 4.3 CD14 functions 35 1. 4.4 LPS binding to CD14 36 1. 4.5 CD14 and its receptor complex 38 1. 4.6 CD14 and its signaling ... using the TIR1/TIR2-based 11 9 assay 4.2 Effects of CD14 deletions and point mutations in its loop 12 / 13 and 13 on its dimerization 12 2 4.3 Effect of CD14 mutation on its response o LPS 12 4 4.4 ... purification for transfection 69 2 .1. 2 .10 Quantitation of DNA 70 2 .1. 2 .11 Restriction endonuclease digestion 70 2 .1. 2 .12 DNA ligation 71 IV 2 .1. 2 .13 Preparation of competent cells 71 2 .1. 2 .14 Transformation...
- 236
- 494
- 0
Globalization and its effects on the development of educational service in Vietnam
... migration 1. 3.3.3 Types of education 1. 4 The effects of globalization on education 1. 4 .1 The effects of trade on education 1. 4 .1. 1Trade and demand for education at macro level 1. 4 .1. 2 Trade and supply ... (: 0 918 .775.368 1. 3 .1 Education and international trade 1. 3 .1. 1 Education and exports at macro level 1. 3 .1. 2 Education and global value chains 1. 3 .1. 3 Education and offshoring services 1. 3 .1. 4 ... Methodology 5.Table of Contents II The Main Content Chapter I: Overview 1. 1 Globalization 1. 1.2 The impact of globalization 1. 1.2 .1 Positive impact 1. 1.2.2 Negative impact 1. 1.2.3 Impact on International...
- 63
- 995
- 3
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx
... ages of 45 and 49 years the incidence is 20 per 10 0,000 Amongst those over 75 years of age, the incidence is over 300 per 10 0,000 for men and 200 per 10 0,000 per year for women The median age of ... from data in the RCT The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE ... cetuximab monotherapy arm (incremental difference 12 .1% , 95% CI 4 .1 to 20.2) The rates of response in the single-arm studies were 8.8% (95% CI 2.9 to 19 .3) and 12 .0% (95% CI 8.4 to 15 .4) in the two...
- 34
- 853
- 0
Tài liệu Closing the gap between research and practice: Foundations for the acquisition of literacy pptx
... acquisition of reading and the effectiveness of different approaches to the teaching of reading, and the implications of this research for teaching practice The most recent of these reports is the Report ... et al, 19 73; Rosen and Rosen, 19 73 11 Closing the Gap paper 17 /1/ 06 9:45 AM Page 12 While these sixteen projects covered a range of topics, they were in most cases descriptive studies of literacy ... years These have included policy documents, such as the 19 91 policy statement Australian Language and Literacy Policy (DEET, 19 91) , and the 19 98 publication Literacy for All: The Challenge for...
- 46
- 1,122
- 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... · 10 10 1. 0 · 10 10 28 21. 11 8.0 · 10 10 7.6 · 10 9 2953.4 nsd – – nsd – – 6 .1 · 10 8 1. 4 · 10 8 5760. 01 1.8 · 10 8 1. 1 · 10 8 13 065.2 nsd – – kcal/mole of injectant dichroweb online software [29,30] There ... series of experiments we compared fibrillation of stefin B wildtype (E 31 isoform), of stefin B variant (Y 31 isoform) and the mutant P79S of the variant, all at pH 5.0 with 10 % TFE, 25 °C, in the presence ... (E 31 isoform) at pH 5, 10 % TFE, 25 °C, and 50 lM Cu2+ in the buffer (C) Stefin B variant (Y 31 isoform) at pH 5, 10 % TFE, 25 °C, and 50 lM Cu2+ in the buffer (D) P79S mutant of variant at pH 5, 10 %...
- 14
- 586
- 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx
... convergence of the PEX5- and PEX7-dependent import pathways [15 17 ] The N-terminal part of PEX14 interacts with the repeated motifs WXXXF/Y of PEX5 [18 ] and with the SH3 domain of PEX13 through ... of the trypanosomatid vector pHD677 (giving pRP14) [25] For induction of double-stranded RNA, cells were cultured in the appropriate medium [25] containing 250 ngÆmL )1 of Tet for bloodstream-form ... shown that the N-terminal part of PEX14 is responsible for the interaction with PEX5 [16 , 31, 32] This N-terminal domain of the polypeptide of each of these organisms is followed by a stretch of hydrophobic...
- 9
- 549
- 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
... ( 310 ) 31. 37 (220) 28.6 (11 1) 30.2 (12 2) 26.8 (11 2) 32.5 (11 0) 31. 82 (10 0) 30.5 (11 1) 19 .3 (11 1) 15 .38 (200) 28 (11 1) 16 ( 011 ) 37.2 (12 1) 36.88 ( 311 ) 33 .1 (200) 37.2 (222) 33.8 (006) 35.5 ( -11 0) ... pollutants 11 1. 1.2 .1 Carbon monoxide (CO) 11 1. 1.2.2 Volatile organic compounds (VOCs) 11 1. 1.2.3 Nitrous oxides (NOx) 12 1. 1.2.4 Some other pollutants 12 1. 1.3 Composition of exhaust gas 13 1. 2 Treatments ... Techniques 2.2 .1 19 35 Synthesis of the catalysts 2 .1. 1 2 .1. 2 2 .1. 3 14 14 14 14 15 16 17 17 Mechanism of hydrocarbon oxidation over transition metal oxides 28 Mechanism of the oxidation reaction of carbon...
- 117
- 376
- 0
báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx
... 1) ! [0,T ]4 2 2 R2d n ( 1 1 )2k1 (ξ2 η2 )2k2 (ξd ηd )2kd d 1 dξd d 1 dηd k1 , ,kd =0 k1 +···+kd =n = (2π)d ∞ n n =1 k1 , ,kd =0 k1 +···+kd =n 2n(2k1 − 1) !! · · · · · (2kd − 1) !! (2k1 ... where 2H 1 2H f (x) := (2 − )x − 1+ x 2H 1 − (1 + x)2H − (1 − x)2H 2 , and g(x, y) =(2 − 22H 1 )2 x2H + y 2H 1 − + x2H − (1 + x)2H − (1 − x)2H 2 1 × + y 2H − (1 + y)2H − (1 − y)2H 2 (3.7) For simplicity ... for all t, s ≥ Existence of the intersection local time The aim of this section is to prove the existence of the intersection local time of S H and S H , for an H = and d ≥ We have obtained the...
- 21
- 532
- 0
Báo cáo hóa học: " Fowlpox virus recombinants expressing HPV-16 E6 and E7 oncogenes for the therapy of cervical carcinoma elicit humoral and cell-mediated responses in rabbits" pot
... 2003, 16 :11 1 -12 1 14 Meneguzzi G, Cerni C, Kieny MP, Lathe R: Immunization against human papillomavirus type 16 tumor cells with recombinant vaccinia viruses expressing E6 and E7 Virology 19 91, 18 1:62-69 ... T2-T3 and T4-T5 vs T1, p < 0. 01 and p < 0.0 01) and boosting (Protocol 3/E7, P3 vs P1, P2, P4, p < 0.0 01; P1-P3 vs T1-T5, p < 0.05) The co-administration of FPE6 + FPE7 elicited a balanced Th1/Th2 ... diluted 1: 25 or 1: 250 for protein-coated plates, and 1: 4000 for plates coated with CaSki lysates The reactions were revealed with goat anti-rabbit HRP-conjugated sera (1: 1000) and TMB substrate The...
- 12
- 456
- 0
báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot
... 19 44 28 60 43 54 42 24 28 39 63 50 39 42 39 40 59 33 26 24 48 30 55 62 23 43 23 56 42 37 42 L1 T 11 T12 L1 T12 T12 T12 T 11 T12 T12 L1 L1 T12 L1 T12 L1 T12 T 11 T12 T 11 L1 T12 T12 L1 L1 T 11 T 11 ... model J Bone Joint Surg Am 19 88, 70 :11 82- 91 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Krag MH: Biomechanics of thoracolumbar spinal fixation: A review Spine 19 91, 16 :S84-99 McAfee PC, Yuan HA, ... 2004 and June 2006 at our institute by a single spine surgeon (Table 1) There were 18 males and 13 females with an average age of 40.6 ± 12 .7 (range, 19 ~63 years) There were 7, 13 and 11 patients...
- 6
- 519
- 1
Báo cáo hóa học: " Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions Guangjun Shen" pptx
... 22H1 )2 x2H + x2H 1 (1 + x)2H (1 x)2H 2 , Shen Journal of Inequalities and Applications 2 011 , 2 011 :13 9 http://www.journalofinequalitiesandapplications.com/content/2 011 /1/ 139 Page of 16 and ... (3 :11 ) Shen Journal of Inequalities and Applications 2 011 , 2 011 :13 9 http://www.journalofinequalitiesandapplications.com/content/2 011 /1/ 139 Page of 16 where the integral in r is convergent if and ... dldv Shen Journal of Inequalities and Applications 2 011 , 2 011 :13 9 http://www.journalofinequalitiesandapplications.com/content/2 011 /1/ 139 Page 15 of 16 for s t T Thus, Theorem and Fatous lemma...
- 16
- 406
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008