... conformations ofthe b-amino acidsbackbone, corresponding to gauche rotamers around the Ca–Cb bond, can overlap canonical backbone conformersobserved for a- amino acids. Therefore the addition of ... representation ofthe amino acid sequence 9 10 ofthe SP analogues 1 10 (pharmacological data in Table 1) . Rectangles underanalogues indicate compounds that have a nity for the two (NK-1M/NK-1m) binding ... [3H]propionyl[Met(O2 )11 ]SP(7 11 ) andassociated with the production of inositol phosphates. The binding and agonist potencies ofthe SP analogues areFig. 3. Chemical shift deviations of Ha (A) and Ca (B) for the...
... bacterial target, and underscores the fact that the bacterial membraneis the major target for the killing mechanism of Esc (1 18 ), rather thanintracellular processes.AbbreviationsCFU, colony-forming ... asdetailed in Table 3.AcknowledgementsWe thank M. Simmaco for use ofthe facilities andplatforms available in the DiMA Unit ofthe Sant’An-drea Hospital. This work was funded in part by ItalianMinistero ... isothiocyanate–dextran of 10 kDa average molecular mass;FITC-D 40, fluorescein isothiocyanate–dextran of 40 kDa average molecular mass; FITC-D 70, fluorescein isothiocyanate–dextran of 70 kDaaverage...
... crystal nanorod morphology. From the sawtooth morphology we can speculate that the formation of 1- D nanostructure may have come from the nanoparticle aggregation, at the same time oriented aggregation ... mL capacity. The autoclave was maintained at a temperature of 18 0°C for 12 h without stirring and shaking during heating and then was allowed to cool to ambient temperature naturally. The ... Kockelmann W and Bruce P G 2006 J. Am. Chem. Soc. 12 8 5468 Kotsikau D, Ivanovskaya M, Orlik D and Falasconi M 2004 Sensor Actuat. B1 01 199 Rumyantseva M et al 2006 Sensor Actuat. B 118 208 Sorescu...
... 307–326. 17 Collaborative Computational Project N (19 94) The CCP4 suite: programs for protein crystallography. ActaCrystallogr D 50, 760–763. 18 Navaza J (19 94) AMoRe: an automated package formolecular ... at both ends. In the case of Xgh7 4A, the active cleft is open. Although a precise anal-ysis ofthe mode of action of Xgh7 4A has not beenperformed, Xgh7 4A appears to be an endoglucanasebecause ... program [19 ] was used forrefinement against the 20–2.5 A ˚intensity data. A ran-domly selected portion ofthe diffraction data (5.0%)was used to calculate the free R factor [20]. The pro-gram...
... winning and losingã Relational: If you get along, others will go along. Partnering for ProfitabilityMary Morstadt, National City Mortgage,March 20, 2006 The way a team plays as a whole ... success.”-Babe Ruth The 17 Essential Qualities of a Team Playerby John C. MaxwellãAdaptable: Blessed are the flexible, for they shall not be bent out of shapeã Collaborative: Working together ... RESmall businessLocal bank presidentCharitable contribPublic affairsNatCityInvestments 17 Essential Qualities (cont.)ã Enlarging: A dding value to teammates is invaluableã Enthusiastic:...
... J. Combinato-rial Theory Ser. A, 18 , 14 1 14 8, 19 75.[4] Foata, D.: Groupes de r´earrangements et nombres d’Euler. C. R. Acad. Sci. ParisSr. A- B, 275, A 114 7 A 115 0, 19 72.[5] Foata, D. and Strehl, ... 0) and Tn(2, 0). We present an algebraic proof ofa resultwith the same flavour as the latter: Tn+2 (1, 1) = Tn(2, 1) , where Tn (1, 1) has the combinatorial interpretation of being the ... 2, 1) and T (Kn+2; 1, 1) Let us assume that the vertices of Knare labelled 1, 2, . . . , n. For a spanning tree A of Kn, an inversion in A is a pair of vertices labelled i,j such that...
... negativeeigenvalue.As the cliques ofthe oppositeness graph on g enerators ofa polar space are precisely the partial spreads, we can now prove the main result.Theorem 4.2. A partial spread ... ofa polar space is a set of pairwise disjoint generato rs. If these generator sform a par t itio n ofthe points ofthe polar space, it is said to be a spread. Thas [10 ] provedthat in the ... + 1 subspaces Vi, all of them eigenspaces ofthe relations Rj of the association scheme. The (D + 1) ì (D + 1 )-matrix P , where Pijis the eigenvalue of the relation Rjfor the eigenspace...
... an analysis of variance (normal versus translocation half-sibs). A sample of 85 normal and 12 1translocation records from one farm was available for analysis. The weaning ... that the translocation wasintroduced into South Africa by cattle imported from the USA. The anomaly was absent in a random sample of unrelated Brahman cattle.Key words ... random sample of 19 0 unrelatedBrahman cattle. The latter group was studied in order to investigate the incidence of the translocation in the general population. Giemsa...
... P432 1 2P432 1 2P2 1 2 1 2 1 Temperature (K) 10 0 10 0 11 0Detector Mar CCD 16 5 mm MAR IP 345 Mar CCD 16 5 mmUnit-cell parameters a (A ˚) 13 4.00 13 3.69 81. 71 b (A ˚) 13 4.00 13 3.69 12 2.93c (A ˚) 11 1. 31 111 .24 ... recognition. For the superposi-tion ofthe substrate-free PhyK with substrate-freeAppA the C a atoms are 2. 41 A ˚apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged ... domains, a large a ⁄ bdomain and a small a domain with the catalytic site at the interface ofthe two domains [4,5]. HAPs can initi-ate hydrolysis of phytate at either the C3(EC 3 .1. 3.8)or...
... one was metal evaporation from an effusion cell at a substrate temperature of 550 1C in order to form dropletson the substrate, and the last step was the evaporation of silicon at the same substrate ... composition ofthe surface afterinserting the sample into our growth chamber, we take data of similar surfaces from the literature as an approximation.Asay and Kim [15 ] expect the surface energy ofa ... in the present work indium wasalso applied, as it may bring some advantages for later electronic application ofthe wires. The main focus of this work is the behavior of gold and indium on a...
... AmyFor-NdeI (TTTGTTTAACTTTAAGAAGGAGATATACATATGAATCG) and AmyRev-NcoI (aaaaccatGGGCTTTGTTAGCAGCCGGAT). The amplifiedfragment was ligated into the NdeI and NcoI sites of pSY1[30]. A derivative ... mutated to twin lysines (AmyH-KK). The primers used for Quickchange mutagenesis wereAmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACCGTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTCATTCGTCCGCAGAttctttTGGCAAGACTTTCCTTAGC)(bold ... dominant roleofthe Tat system in haloarchaeawas corroborated by the observation that the Tat sys-tem is essential for viability in these organisms [8,9]. The Tat system in bacteria and chloroplasts...
... supervised all the experiments and drafted the manuscript. All authors read and approved the finalmanuscript.Additional materialAdditional File 1 Colocalization of Cav -1 and Gag RFP in transfected A- MLV ... http://www.virologyj.com/content/3 /1/ 73Page 11 of 11 (page number not for citation purposes)functional analysis oftheroleof TM domains in viral entry. JVirol 19 94, 68:3207-3 219 . 41. Hovanessian AG, Briand JP, Said EA, ... co-localization of Env with Cav- 1, a multi-functional membrane protein. Cav -1 is presentin lipid rafts and its oligomerization leads to caveolae for-mation. Caveolae are the main actors for a...