Nghiên cứu tác nhân gây bệnh và biện pháp phòng trừ bệnh thối thân chảy nhựa trên cây mít ở miền đông nam bộ

228 22 0
  • Loading ...
1/228 trang
Tải xuống

Thông tin tài liệu

Ngày đăng: 25/09/2019, 06:22

BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM MAI VĂN TRỊ NGHIÊN CỨU TÁC NHÂN GÂY BỆNH VÀ BIỆN PHÁP PHÒNG TRỪ TỔNG HỢP BỆNH THỐI THÂN CHẢY NHỰA TRÊN CÂY MÍT Ở MIỀN ĐÔNG NAM BỘ LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP TP Hồ Chí Minh - 2018 BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM MAI VĂN TRỊ NGHIÊN CỨU TÁC NHÂN GÂY BỆNH VÀ BIỆN PHÁP PHÒNG TRỪ TỔNG HỢP BỆNH THỐI THÂN CHẢY NHỰA TRÊN CÂY MÍT Ở MIỀN ĐƠNG NAM BỘ Chuyên ngành: Bảo vệ thực vật Mã số: 962112 LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP NGƯỜI HƯỚNG DẪN KHOA HỌC: GS.TS Nguyễn Văn Tuất TS Nguyễn Văn Hòa TP Hồ Chí Minh - 2018 i LỜI CAM ĐOAN Tơi xin cam đoan cơng trình nghiên cứu riêng tơi Tồn số liệu kết nghiên cứu luận án trung thực chưa cơng bố cơng trình nghiên cứu khác Tác giả luận án Mai Văn Trị ii LỜI CẢM ƠN Tơi xin bày tỏ lòng biết ơn chân thành sâu sắc đến tập thể hướng dẫn khoa học GS.TS Nguyễn Văn Tuất, TS Nguyễn Văn Hòa dành nhiều thời gian để góp ý, cho ý tưởng, nội dung nghiên cứu, định hướng phương pháp luận, chỉnh sửa văn phong số vấn đề gặp phải trình thực Xin chân thành cảm ơn đồng ý, hỗ trợ, tạo điều kiện chia sẻ kiến thức lãnh đạo Viện Khoa học Nông nghiệp Việt Nam, Ban Đào tạo Sau ĐH cán tham gia công tác đào tạo; lãnh đạo Viện KHKT Nơng nghiệp miền Nam Phòng QLKH HTQT cán tham gia công tác đào tạo; chân thành cảm ơn đồng ý, động viên hỗ trợ lãnh đạo Viện ăn miền Nam Xin chân thành cảm ơn TS Santa Olga Cacciola, BM Nông nghiệp, Thực phẩm Môi trường, ĐH Catania, Italia; GS Gaetano Magnano di San Lio (ĐH Reggio Calabria Địa Trung Hải, Italia) số đồng nghiệp khác tài trợ giúp đỡ vật liệu, phương tiện cho việc thực số thí nghiệm Xin chân thành cám ơn đồng nghiệp Phòng Bảo vệ thực vật Phòng CN Sau thu hoạch thuộc Viện ăn miền Nam, BM Di truyền SH phân tử thuộc ĐH Cần Thơ, đồng nghiệp Trung tâm Kiểm dịch sau nhập khẩu, TS André Drenth (ĐH Queensland), PGS.TS Nguyễn Minh Châu TS Đinh Thị Yến Phương Chân thành cảm ơn lãnh đạo ngành chun mơn nơng dân trồng mít tỉnh miền Đông Nam động viên, giúp đỡ, hỗ trợ suốt q trình điều tra, thực thí nghiệm hoàn chỉnh luận văn Cuối xin cám ơn anh chị, cháu, gia đình, người thân, tất đồng nghiệp bạn bè động viên, giúp đỡ trình thực luận án Tác giả iii MỤC LỤC LỜI CAM ĐOAN i LỜI CẢM ƠN ii MỤC LỤC iii DANH MỤC TỪ VIẾT TẮT vii DANH MỤC THUẬT NGỮ ĐỐI CHIẾU VỚI TIẾNG ANH viii DANH MỤC CÁC BẢNG ix DANH MỤC CÁC HÌNH xii MỞ ĐẦU 1 Tính cấp thiết đề tài .1 Mục tiêu, yêu cầu đề tài Những đóng góp luận án Ý nghĩa khoa học ý nghĩa thực tiễn đề tài 1.2.3 Một số đặc điểm canh tác .3 Đối tượng phạm vi nghiên cứu CHƯƠNG TỔNG QUAN CÁC VẤN ĐỀ NGHIÊN CỨU 1.1 Cơ sở khoa học đề tài 1.2 Một số thông tin mít 1.2.1 Nguồn gốc, đặc điểm thực vật học, sản xuất sử dụng 1.2.2 Một số giống mít miền Đông Nam 11 1.2.4 Một số sâu bệnh hại mít 13 1.3 Bệnh thối thân chảy nhựa (TTCN) hại mít 15 1.4 Một số đặc điểm hình thái sinh học Phytophthora 16 1.4.1 Chi Phytophthora 16 1.4.2 Phân lập Phytophthora 17 1.4.3 Chu kỳ sống (life cycle) Phytophthora 19 iv 1.4.4 Loài Phytophthora palmivora 21 1.4.5 Xác định loài Phytophthora gây bệnh trồng 24 1.4.6 Một số yếu tố sinh thái ảnh hưởng phát triển Phytophthora 26 1.5 Chu kỳ bệnh (disease cycle) Phytophthora 27 1.6 Một số biện pháp phòng trừ bệnh gây Phytophthora 31 1.6.1 Biện pháp canh tác 31 1.6.1.1 Ngăn ngừa nguồn bệnh xâm nhập, lây lan sử dụng giống bệnh .31 1.6.1.2 Thoát nước vườn 32 1.6.1.3 Bón phân hữu 33 1.6.2 Biện pháp giống chống chịu bệnh 34 1.6.3 Biện pháp sinh học 35 1.6.4 Phòng trừ thuốc hóa học 37 1.6.5 Phòng trừ tổng hợp bệnh Phytophthora 41 1.7 Nhận xét chung tình hình nghiên cứu bệnh thối thân chảy nhựa hại mít 42 CHƯƠNG VẬT LIỆU, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU .44 2.1 Vật liệu nghiên cứu 44 2.1.1 Môi trường ni cấy, hóa chất, trang thiết bị dụng cụ sử dụng chung .44 2.1.2 Nguồn Phytophthora 45 2.1.3 Các giống ăn 46 2.2 Thời gian địa điểm nghiên cứu 46 2.2.1 Thời gian thực 46 2.2.2 Địa điểm thực 46 2.3 Nội dung nghiên cứu 47 2.4 Phương pháp phương tiện nghiên cứu 47 2.4.1 Phương pháp điều tra tình hình bệnh thối thân chảy nhựa 47 2.4.2 Phương pháp thu thập phân lập mẫu 48 2.4.3 Phương pháp xác định loài Phytophthora gây bệnh 53 v 2.4.4 Nghiên cứu đặc điểm sinh học sinh thái loài P palmivora 56 2.4.5 Nghiên cứu đặc điểm phát sinh- phát triển bệnh TTCN đồng 60 2.4.6 Nghiên cứu biện pháp phòng trừ bệnh thối thân chảy nhựa 63 2.4.6.1 Nghiên cứu tuyển chọn giống mít có khả chống chịu bệnh TTCN 63 2.4.6.2 Nghiên cứu ảnh hưởng số biện pháp canh tác bệnh TTCN 66 2.4.6.3 Nghiên cứu khả giảm bệnh TTCN hại mít T harzianum điều kiện đồng ruộng 72 2.4.6.4 Nghiên cứu phòng trừ bệnh TTCN hại mít sử dụng thuốc hóa học 74 2.4.7 Xây dựng mơ hình phòng trừ tổng hợp bệnh TTCN hại mít 77 2.5 Phương pháp xử lý, chuyển đổi số liệu cho thí nghiệm 79 CHƯƠNG KẾT QUẢ VÀ THẢO LUẬN 81 3.1 Triệu chứng bệnh thối thân chảy nhựa mít Đông Nam .81 3.2 Phân lập, xác định tác nhân gây bệnh TTCN hại mít Đông Nam 86 3.2.1 Phân lập tác nhân gây bệnh TTCN hại mít Đơng Nam 86 3.2.2 Kết lây nhiễm nhân tạo tái phân lập ký sinh gây bệnh 87 3.2.3 Xác định loài Phytophthora biện pháp hình thái 91 3.2.4 Xác định loài Phytophthora gây bệnh phương pháp sinh học phân tử 95 3.3 Nghiên cứu số đặc điểm sinh học, sinh thái mẫu Phytophthora phân lập mít miền Đơng Nam 99 3.3.1 Xác định kiểu ghép cặp (mating type, kiểu lai) mẫu phân lập 99 3.3.2 Ảnh hưởng nhiệt độ đến phát triển tản nấm P palmivora 100 3.3.3 Ảnh hưởng nhiệt độ đến khả tạo bào tử nang P palmivora 102 3.3.4 Ảnh hưởng mức pH môi trường đến tăng trưởng P palmivora .103 3.3.5 Khả gây bệnh P palmivora số loài ăn 105 3.4 Nghiên cứu đặc điểm phát sinh, phát triển bệnh TTCN hại mít 107 3.4.2 Diễn biến năm bệnh TTCN hại mít khu vực miền Đông Nam 109 3.4.3 Điều tra ảnh hưởng số yếu tố kỹ thuật canh tác sinh thái đến bệnh TTCN hại mít .113 vi 3.4.3.1 Ảnh hưởng giống trồng đến bệnh TTCN 113 3.4.3.3 Ảnh hưởng độ tuổi vườn đến bệnh TTCN 116 3.4.3.4 Ảnh hưởng địa hình vườn đến bệnh TTCN 117 3.4.3.5 Ảnh hưởng trồng trồng xen đến bệnh TTCN hại mít 118 3.5 Nghiên cứu biện pháp phòng trừ bệnh TTCN hại mít 120 3.5.1 Nghiên cứu tuyển chọn giống mít chống chịu bệnh TTCN 120 3.5.2 Nghiên cứu phòng trừ bệnh TTCN hại mít biện pháp canh tác 129 3.5.3 Nghiên cứu ảnh hưởng xử lý T harzianum đến bệnh TTCN hại mít điều kiện đồng ruộng 143 3.5.4 Nghiên cứu phòng trừ bệnh thuốc hóa học 148 3.5.5 Kết thực mơ hình phòng trừ tổng hợp bệnh TTCN hại mít 161 4.1 Kết luận 167 4.2 Đề nghị 168 DANH MỤC CÁC CÔNG TRÌNH ĐÃ CƠNG BỐ 169 TÀI LIỆU THAM KHẢO 170 -Tài liệu tham khảo tiếng Việt 170 -Tài liệu tham khảo tiếng Anh 172 PHỤ LỤC 189 vii DANH MỤC TỪ VIẾT TẮT BLAST Basic Local Alignment Search Tool BRVT Bà Rịa Vũng Tàu BVTV Bảo vệ Thực vật CRA Môi trường nuôi cấy CRA (cà rốt agar) CSB Chỉ số bệnh CV Coefficient of variation DNA Deoxyribonucleic Acid Dntp Deoxynucleotide FAO Food and Agriculture Organization of United Nations ITS Internal transcribed spacer NCBI National Center for Biotechnology Information NN&PTNT Nông nghiệp Phát triển Nông thôn Nxb Nhà xuất PCR Polymerase Chain Reaction PDA Môi trường nuôi cấy PDA (Potato Dextrose Agar) PSM Môi trường chọn lọc Phytophthora RCBD Randomized Complete Block Design RNA Ribonucleic acid SXL Sau xử lý TLB Tỷ lệ bệnh TTCN Thối thân chảy nhựa TXL Trước xử lý UK United Kingdom UV Untra-violet viii DANH MỤC THUẬT NGỮ ĐỐI CHIẾU VỚI TIẾNG ANH Tiếng Vi ệt Tiếng Anh Bào tử động/động bào tử Zoospores Bào tử hậu/hậu bào tử Chlamydospores Bào tử nang Sporangia Bào tử noãn Oospore Bộ Order Cấu trúc cái/túi noãn Oogonium Cấu trúc đực/ bao đực Antheridium Chi Genus Cuống (của bào tử nang) Pedicel Giới Kingdom Họ Family Khuẩn ty/sợi nấm Mycelium Kiểu dị tản Heterothallic Kiểu đồng tản Homothallic Kiểu ghép đơi/kiểu lai Mating types Lồi Species Lông roi Flagella Mẫu phân lập Isolate Mốc nước Water moulds Nang Cyst Ngành Phylum Núm (của bào tử nang) Papillate Túi giao tử Gametangia 199 Phụ lục 5: Xác định loài Phytophthora ứng dụng phương pháp sinh học phân tử i) Trình tự vùng COX II bốn mẫu MD3, MD5, MD6 MD8 sau sản phẩm khuyếch đại PCR với mồi FM75 FM78 giải trình tự: TCTCTTCTTATAAACATTGATGTTTGATTTAAACGTCCTGGACATGCATCTA ATTTAATACCTAATGAAGGTATAGCCCATGAATGTAAAACATCTGATGCAG TAATTAATACTCTAATATGACTATTAGTAGGAACTACTACACGATTATCTAC TTCTAAAATTCTAAATTGACCAATTGCTAAATCATCCTCTTGTACCATGTAA CTATCAAAAATTAAAGGTTCATCTGAAAATTCTAAATTATCTGAATATTCAT AACTCCAATACCATTGACTACCTATAACTTTTAAAGTTATAATTGGATCAAT TACTTCATCCATAGAATATAATAAAGCAAAAGATGGAATTGCAACAGTTAA TAGAATTAAAGCTGGAATAGAAGTCCAAATAATTTCAATAGTAGCACCATG TACAATAGTTGATGGGATTTTATTGTTTTTTTCATCAAAAAGAGTAATAACT CTAAATAACATCCAACAAACAAATACAGTAATCATAATTAAAAAAAACCA TTAAATCATGATGAAAAGTTAATAATACCTTCCA Ghi chú: Tuy sản phẩm khuyếch đại có độ dài 563 bp giải trình tự, máy giải trình tự thường khơng đọc nucleotide đoạn đầu (do nhiễu bước sóng) nên 549 bp + Kết tìm trình tự tương đồng (blast) COX II bốn mẫu phân lập MD3, MD5, MD6 MD8 (cùng trình tự) cho thấy tương đồng với trình tự dòng P palmivora (trên) 200 -Kết so sánh trình tự COX II MD5 (Query) với trình tự COX II dòng P palmivora NRCPh-79 (Sbjct) cho thấy độ tương đồng 99% ii) Trình tự vùng ITS1-5.8S-ITS2 mẫu MD5 sau PCR với mồi ITS4 ITS6 >KF823978.1 P palmivora isolate MD5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence CCTAAAAACTTTCCACGTGAACCGTATCAAAACTTAGTTGGGGGTCTCTTTCGGCG GCGGCTGCTGGCTTCATTGCTGGCGGCTGCTGTTGGGAGAGCTCTATCATGGCGA GCGTTTGGGCTTCGGTCTGAACTAGTAGCTTTTTTAAACCCATTCTTTATAACTGAT 201 TATACTGTAGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGG ATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGA ATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTA GTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCC GTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGAT CGGCTGTGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCCAAAAGCGT GGCGTTGCTGATTGTGGAGGCTGCTTGCGTAGCCAGTCTGGCGACCAGTTTGTCTG CTGTGGCGTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAAC AGACGCTTATTGAATATTTCTTCAGCTGTGGTGGTATGATTGGTGAACCGTAGCTA TGTGAGCTTGGCTTTTGAATTGGCTTTGCTGTTGCGAAGTAGAGTGGCGGCTTCGG CTGTCGAGGGTCGATCCATTTGGGAACTTGTGTATGCTTCGGCATGCATCTCAATT GGA + Trình tự vùng ITS1-5.8S-ITS2 mẫu MD6 sau PCR với mồi ITS4 ITS6 >KF823979.2 Phytophthora palmivora isolate MD6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence CCTAAAAACTTTCCACGTGAACCGTATCAAAACTTAGTTGGGGGTCTCTTTCGGCG GCGGCTGCTGGCTTCATTGCTGGCGGCTGCTGTTGGGAGAGCTCTATCATGGCGA GCGTTTGGGCTTCGGTCTGAACTAGTAGCTTTTTTAAACCCATTCTTTATAACTGAT TATACTGTAGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGG ATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGA ATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTA GTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCC GTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCGGCTGGTCTTCGGAT CGGCTGTGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCCAAAAGCGT GGCGTTGCTGATTGTGGAGGCTGCTTGCGTAGCCAGTCTGGCGACCAGTTTGTCTG CTGTGGCGTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAAC AGACGCTTATTGAATATTTCTTCAGCTGTGGTGGTATGATTGGTGAACCGTAGCTA TGTGAGCTTGGCTTTTGAATTGGCTTTGCTGTTGCGAAGTAGAGTGGCGGCTTCGG CTGTCGAGGGTCGATCCATTTGGGAACTTGTGTATGCTTCGGCATGCATCTCAAT Ghi chú: Tuy sản phẩm khuyếch đại có độ dài khoảng 900 bp giải trình tự, máy giải trình từ thường khơng đọc nucleotide đoạn đầu (do nhiễu bước sóng) nên 782-786 bp 202 + Kết tìm trình tự tương đồng (blast) ITS1-5.8S-ITS2 mẫu phân lập MD5 cho thấy tương đồng với trình tự tương ứng dòng Phytophthora palmivora +Kết so sánh trình tự ITS1-5.8S-ITS2 MD5 (Query) với trình tự ITS1-5.8SITS2 dòng Phytophthora palmivora có ID GQ398157 (Sbjct) cho thấy độ tương đồng 100% 203 Phụ lục Tóm tắt kết thống kê kết thí nghiệm 6.1 Nghiên cứu đặc điểm sinh học loài Phytophthora - Ảnh hưởng nhiệt độ đến phát triển đường kính tản nấm P palmivora Nguồn biến động (1) ngày (2) ngày (3) ngày Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 0,92% Tổng bình phương 52,362 0,003 52,365 177,413 0,002 177,415 328,251 0,003 328,254 CV(2) = 0,51% Độ tự 12 26 38 12 26 38 12 26 38 Trung bình bình phương 4,363 0,0001 F tính Khác biệt 43634,974 0,000 14,784 0,0001 250692,754 0,000 27,354 0,0001 237070,070 0,000 F tính Khác biệt 80803,650 0,000 CV(3) = 0,60% - Ảnh hưởng nhiệt độ đến sinh sản bào tử nang P palmivora Nguồn biến động Số bào từ nang Nghiệm thức Sai số Tổng cộng Tổng Độ tự bình phương 179,564 0,005 18 179,569 26 Trung bình bình phương 22,445 0,0003 CV = 1,25% 6.2 Ảnh hưởng pH đến phát triển đường kính tản nấm P palmivora Nguồn biến động (1) ngày (4) ngày Tổng Độ tự bình phương Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 1,22% CV(2) = 51,305 0,005 51,310 161,395 0,047 161,442 CV(3) = 13 28 41 13 28 41 Trung bình bình phương F tính Khác biệt 3,947 0,0002 23345,834 0,000 12,415 0,002 7406,663 0,000 CV(4) = 2,93 204 6.4 Nghiên cứu biện pháp phòng trừ 6.4.1 Nghiên cứu biện pháp phòng trừ sử dụng tính kháng -Diện tích vết bệnh trung bình (cm ) giống/dòng mít sau lây nhiễm Nguồn biến động (1) DTVB 4N (2) DTVB 5N (3) DTVB 6N (4) DTVB 7N Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 7,80% Tổng bình phương 233,496 1,338 234,834 689,905 7,653 697,557 2439,236 16,114 2455,350 4419,580 22,358 4441,937 CV(2) = 5,50% Độ tự 21 66 87 21 66 87 21 66 87 21 66 87 Trung bình bình phương 11,119 0,020 CV(3) = 4,10% F tính Khác biệt 548,670 0,000 32,853 0,116 283,342 0,000 116,154 0,244 475,735 0,000 210,456 0,339 621,273 0,000 CV(4) = 3,19% - Chiều dài vết bệnh trung bình (mm) đoạn cành sau lây nhiễm P palmivora Nguồn biến động Tổng Độ tự Trung bình F tính bình phương bình phương (1) Nghiệm thức 2728,773 21 129,942 659,703 CDVB Sai số 13,000 66 0,197 4N Tổng cộng 2741,773 87 (2) Nghiệm thức 5393,270 21 256,822 387,468 CDVB Sai số 43,746 66 0,663 5N Tổng cộng 5437,016 87 Nghiệm thức 23670,130 21 1127,149 1034,213 (3) CDVB Sai số 71,931 66 1,090 6N Tổng cộng 23742,061 87 (4) Nghiệm thức 21766,284 21 1036,490 580,617 CDVB Sai số 117,820 66 1,785 7N Tổng cộng 21884,104 87 CV(1) = 10,67 % CV(2) = 8,31% CV(3) = 4,93% CV(4) = 3,73% Khác biệt 0,000 0,000 0,000 0,000 205 -TLB (%) từ hạt bảy giống mít trồng lây bệnh P palmivora Nguồn biến động (1) tháng SLN (2) tháng SLN Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 16,82% Tổng bình phương 827,399 570,195 1397,594 3386,457 1321,399 4707,856 Độ tự 21 27 21 27 Trung bình bình phương 137,900 27,152 564,410 62,924 F tính Khác biệt 5,079 0,002 8,970 0,000 CV(2) = 12,57% 6.4.2 Nghiên cứu biện pháp phòng trừ sử dụng biện pháp canh tác -Ảnh hưởng biện pháp tiêu nước đến TLB (%) qua năm (2013-2015) Nguồn biến động (1) Jan-2013 (2) Oct-2013 (3) Oct-2014 (4) Oct-2015 Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 25,60% Tổng bình phương 0,427 3,136 3,563 1,177 2,826 4,004 3,091 2,118 5,209 6,458 4,139 10,597 CV(2) = 15,94% Độ tự 16 19 16 19 16 19 16 19 Trung bình bình phương 0,142 0,196 CV(3) = 10,53% F tính Khác biệt 0,726 0,848 0,392 0,177 2,221 0,125 1,030 0,132 7,783 0,002 2,153 0,259 8,321 0,000 CV(4) = 12,74% 206 -Ảnh hưởng biện pháp tiêu thoát nước đến CSB loét thân qua năm (2013-2015) Nguồn biến động (1) Jan-2013 (2) Oct-2013 (3) Oct-2014 (4) Oct-2015 Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 21,46% Tổng bình phương 0,038 0,750 0,788 0,913 0,994 1,907 4,016 0,908 4,924 5,773 0,808 6,581 CV(2) = 18,25% Độ tự 16 19 16 19 16 19 16 19 Trung bình bình phương 0,013 0,047 F tính Khác biệt 0,267 0,848 0,304 0,062 4,899 0,013 1,339 0,057 23,602 0,000 1,924 0,051 38,097 0,000 CV(3) = 12,67 % CV(4) = 9,59% + Thí nghiệm ảnh hưởng bón số phân hữu đến bệnh -Ảnh hưởng bón phân hữu đến tỷ lệ bệnh điều kiện nhà lưới Nguồn biến động (1) Tỷ lệ sau lây nhiễm (2) Tỷ lệ tái phân lập Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 7,91% Tổng bình phương 122,033 2,010 124,044 171,412 2,06 173,476 CV(2) = 8,04% Độ tự 15 19 15 19 Trung bình bình phương 30,508 0,134 42,852 0,137 F tính Khác biệt 227,627 0,000 227,627 0,000 207 -Ảnh hưởng bón số phân hữu đến tỷ lệ bệnh thối thân chảy nhựa Nguồn biến động (1) Jan-2013 (2) Oct-2013 (3) Oct-2014 (4) Oct-2015 Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 24,34% Tổng bình phương 1,084 3,352 4,436 2,088 4,452 6,540 0,659 2,706 3,364 0,718 4,341 5,060 CV(2) = 20,47% Độ tự 15 19 15 19 15 19 15 19 Trung bình bình phương 0,271 0,223 F tính Khác biệt 1,213 0,896 0,522 0,297 1,759 0,190 0,165 0,180 0,913 0,482 0,180 0,289 0,620 0,655 CV(3) = 12,14% CV(4) = 12,60% -Ảnh hưởng bón số phân hữu đến số bệnh Nguồn biến động (1) Jan-2013 (2) Oct-2013 (3) Oct-2014 (4) Oct-2015 Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 20,97% Tổng bình phương 0,142 3,598 3,739 0,192 0,898 1,090 0,502 0,605 1,107 2,197 1,469 3,666 CV(2) = 15,03% Độ tự 15 19 15 19 15 19 15 19 Trung bình bình phương 0,035 0,240 F tính Khác biệt 0,148 0,961 0,048 0,060 0,804 0,542 0,125 0,040 3,109 0,048 0,549 0,098 5,609 0,006 CV(3) = 10,12% CV(4) = 10,64% 208 -Ảnh hưởng bón số phân hữu đến trung bình suất Nguồn biến động Nghiệm thức NS PHC Sai số Tổng cộng Tổng bình phương 615,029 215,153 830,182 Độ tự 15 19 Trung bình bình phương 153,757 14,344 F tính Khác biệt 10,720 0,000 CV = 9,49% 6.4.3 Nghiên cứu biện pháp phòng trừ sử dụng phương pháp sinh học + Ảnh hưởng áp dụng Trichoderma đến TLB (%), CSB(%) TB suất -Ảnh hưởng áp dụng Trichoderma đến tỷ lệ bệnh thối thân chảy nhựa hại mít Nguồn biến động (1) TLB TXL (2) TLB Năm 2015 (3) TLB Năm 2016 Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 25,38% Tổng bình phương 3,147 5,342 8,489 8,919 2,503 11,422 12,205 4,189 16,394 CV(2) = 11,76% Độ tự 18 23 18 23 18 23 Trung bình bình phương 0,629 0,297 F tính Khác biệt 2,121 0,688 1,784 0,139 12,827 0,000 2,441 0,233 10,489 0,000 CV(3) = 14,38% -Ảnh hưởng áp dụng Trichoderma đến số bệnh thối thân chảy nhựa hại mít Nguồn biến động (1) CSB TXL (2) CSB 1N STN (3) CSB 2N STN Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 27,12% Tổng bình phương 0,977 3,077 4,054 2,327 1,897 4,224 4,251 0,930 5,181 CV(2) = 17,62% Độ tự 18 23 18 23 18 23 Trung bình bình phương 0,195 0,171 F tính Khác biệt 1,143 0,709 0,465 0,105 4,417 0,008 0,850 0,052 16,459 0,000 CV(3) = 11,47% 209 -Mật độ quần thể Trichoderma spp đất trước sau thí nghiệm Nguồn biến động (1) TLB TXL (2) TLB Năm 2015 (3) TLB Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Năm 2016 Tổng cộng CV(1) = 15,88% Tổng bình phương Độ tự Trung bình bình phương 0,032 10,713 10,745 1016,768 147,590 1164,358 2184,627 225,998 2410,625 18 23 18 23 18 23 0,006 0,595 0,011 1,000 203,354 8,199 24,801 0,000 436,925 12,555 34,800 0,000 CV(2) = 15,74% F tính Khác biệt CV(3) = 14,67% - Ảnh hưởng xử lý nấm Trichoderma SR18 đến trung bình suất (kg/cây) Nguồn biến động TB NS vụ Nghiệm thức Sai số Tổng cộng Tổng bình phương 856,065 425,470 1281,535 Độ tự 18 23 Trung bình bình phương 171,213 23,637 F tính Khác biệt 7,243 0,000 CV = 11,29% 6.4.4 Nghiên cứu biện pháp phòng trừ sử dụng biện pháp hóa học -Ảnh hưởng thuốc hóa học đến TLB (%) tỷ lệ diện (%) P palmivora giá thể giai đoạn vườn ươm Nguồn biến động (1) Triệu chứng (2) TLHD nấm Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 12,10% Tổng bình phương 9,590 2,130 11,720 1028,042 769,243 1797,285 CV(2) = 8,57% Độ tự 20 24 20 24 Trung bình bình phương 2,397 0,107 257,011 38,462 F tính Khác biệt 22,506 0,000 6,682 0,000 210 + Ảnh hưởng số thuốc hóa học đến TLB CSB trước xử lý, năm SXL -Ảnh hưởng số loại thuốc hóa học đến TLB mít giai đoạn kinh doanh Nguồn biến động (1) TLB TXL (2) TLB Năm (3) TLB Năm Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 10,44% Tổng bình phương 0,562 2,248 2,810 5,153 2,333 7,485 9,905 3,819 13,724 CV(2) = 11,09% Độ tự 15 19 15 19 15 19 Trung bình bình phương 0,141 0,150 F tính Khác biệt 0,937 0,469 1,288 ,156 8,283 0,001 2,476 0,255 9,727 0,000 CV(3) = 17,19% -Ảnh hưởng số thuốc hóa học đến CSB mít giai đoạn kinh doanh Nguồn biến động (1) CSB TXL (2) CSB 1N STN (3) CSB 2N STN Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 11,89% Tổng bình phương 0,146 0,719 0,865 3,453 1,178 4,631 7,556 0,794 8,350 CV(2) = 12,22% Độ tự 15 19 15 19 15 19 Trung bình bình phương 0,036 0,048 F tính Khác biệt 0,761 0,567 0,863 0,079 10,992 0,000 1,889 0,053 35,671 0,000 F tính Khác biệt 5,041 0,009 CV(3) = 9,13% -Ảnh hưởng áp dụng số thuốc hóa học đến TB suất Nguồn biến động TB NS Nghiệm thức Sai số Tổng cộng CV = 10,44% Tổng bình phương 330,814 246,096 576,910 Độ tự 15 19 Trung bình bình phương 82,704 16,406 211 + Ảnh hưởng cách xử lý Potassium phosphite đến TLB, CSB NS -Ảnh hưởng cách xử lý Potassium phosphite đến tỷ lệ bệnh Nguồn biến động (1) TLB TXL (2) TLB Năm (3) TLB Năm Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 23,27% Tổng bình phương 0,560 5,141 5,701 5,905 1,848 7,753 17,323 2,158 19,481 CV(2) = 11,48% Độ tự 15 19 15 19 15 19 Trung bình bình phương 0,140 0,343 F tính Khác biệt 0,408 0,800 1,476 0,123 11,981 0,000 4,331 0,144 30,102 0,000 F tính Khác biệt 0,462 0,763 0,735 0,062 11,868 0,000 2,570 0,074 34,855 0,000 CV(3) = 11,46% -Ảnh hưởng cách xử lý Potassium phosphite đến số bệnh Nguồn biến động (1) CSB TXL (2) CSB 1N STN (3) CSB 2N STN Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng Nghiệm thức Sai số Tổng cộng CV(1) = 17,55 % Tổng bình phương 0,138 1,121 1,259 2,940 0,929 3,869 10,280 1,106 11,386 CV(2) = 12,89% Độ tự 15 19 15 19 15 19 Trung bình bình phương 0,034 0,075 CV(3) = 12,28% -Ảnh hưởng biện pháp xử lý Potassium phosphite đến trung bình suất Nguồn biến động Nghiệm thức Năng suất Sai số Tổng cộng CV = 11,07% Tổng bình phương Độ tự Trung bình bình phương 844,697 322,964 1167,661 15 19 211,174 21,531 F tính Khác biệt 9,808 0,000 212 6.4.5 Thống kê t-test trung bình khối lượng trung bình suất mơ hình ứng dụng tổng hợp biện pháp phòng trừ bệnh Nguồn biến động TL Điểm NS TL Điểm NS TL Điểm NS Trung bình 1,77267 31,71267 1,25828 40,22567 1,30600 41,66300 Sai số chuẩn 0,19973 0,69063 0,09677 1,47656 0,12235 1,44266 Độ tự 29 29 29 29 29 29 Giá trị t 8,876 45,919 13,002 27,243 10,674 28,879 Khác biệt 0,0001 0,0001 0,0001 0,0001 0,0001 0,0001 Phụ lục 7: Đặc điểm số loại thuốc/hoạt chất trừ bệnh TT Hoạt chất Tên thương mại/ nhà sản xuất Cơ chế tác động Nhóm độc Thời gian cách ly Copper oxychloride 850g/kg (0,3%) COC 85WP/Curenox OC 85WP Industrias Químicas Del Vallés, S.A.; Spain Hợp chất vơ cơ, có tác động tiếp xúc, phổ tác dụng rộng, tan nước Sau áp dụng, tác dụng CO2 khơng khí, axit hữu nấm bệnh trồng tiết ra, hợp chất từ từ tan + + giải phóng Cu , ion Cu tác động lên bào tử nấm bệnh; làm kết tủa biến tính protein làm bất hoạt enzyme II ngày Metalaxyl 40g/kg + Mancozeb 640 g/kg (0,3%) Ridomil Gold 68WG/ Syngenta Tác động tiêu diệt tế bào nấm bệnh qua hai chế: - Ức chế hoạt động enzyme xúc tác tạo lượng ATP - Ngăn cản tổng hợp RNA tế bào nấm bệnh III 14 ngày FosetylAl800g/kg III 14 ngày Aliette 800WG/ - Thuốc nội hấp, lưu dẫn 213 (0,25%) Potassium phosphite 400 400 g/l monopotassium phosphonate dipotassium phosphonate Bayer Agri-Fos 400 DonaTechno chiều lên xuống - Kìm hãm bào tử nảy mầm hình thành bào tử, ngăn cản phát triển tản nấm - Nội hấp lưu dẫn chiều lên xuống - Cơ chế tác động ‘phức hợp’, kích kháng chủ động, kích thích tiết chất đề kháng Phytoalexin , PR-proteins số chất khác để cơng tiêu diệt mầm bệnh -Tạo tín hiệu báo động cho tế bào lại hình thành hệ thống đề kháng chủ động cho -Giúp sản xuất chất Polysacharides làm dày vách tế bào, phá vỡ lớp ngụy trang nấm bệnh để hệ thống đề kháng phát tiêu diệt IV 1-3 ngày ... [134] Đề tài Nghiên cứu tác nhân gây bệnh biện pháp phòng trừ tổng hợp bệnh thối thân chảy nhựa mít miền Đơng Nam bộ thực nhằm xác định tác nhân gây bệnh phát triển biện pháp nhằm giảm bệnh góp...BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM MAI VĂN TRỊ NGHIÊN CỨU TÁC NHÂN GÂY BỆNH VÀ BIỆN PHÁP PHÒNG TRỪ TỔNG HỢP BỆNH THỐI THÂN CHẢY NHỰA TRÊN CÂY MÍT... phục bệnh thối thân chảy nhựa hại mít miền Đông Nam Mục tiêu, yêu cầu đề tài 2.1 Mục tiêu đề tài Nghiên cứu xác định tác nhân gây bệnh số biện pháp nhằm giảm bệnh thối thân chảy nhựa (TTCN) hại mít
- Xem thêm -

Xem thêm: Nghiên cứu tác nhân gây bệnh và biện pháp phòng trừ bệnh thối thân chảy nhựa trên cây mít ở miền đông nam bộ , Nghiên cứu tác nhân gây bệnh và biện pháp phòng trừ bệnh thối thân chảy nhựa trên cây mít ở miền đông nam bộ

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn